ID: 1114917445

View in Genome Browser
Species Human (GRCh38)
Location 14:27286102-27286124
Sequence AACATCAAGTCCAAGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114917445_1114917451 0 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917451 14:27286125-27286147 GGAATGAGTTAAGACTTTGGGGG 0: 393
1: 1772
2: 1962
3: 1243
4: 847
1114917445_1114917452 14 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917452 14:27286139-27286161 CTTTGGGGGACTGTTGAGAAAGG 0: 12
1: 45
2: 105
3: 137
4: 379
1114917445_1114917450 -1 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917450 14:27286124-27286146 TGGAATGAGTTAAGACTTTGGGG 0: 505
1: 2080
2: 2148
3: 1437
4: 1105
1114917445_1114917448 -3 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917448 14:27286122-27286144 GTTGGAATGAGTTAAGACTTTGG 0: 37
1: 664
2: 2178
3: 2199
4: 1373
1114917445_1114917449 -2 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917449 14:27286123-27286145 TTGGAATGAGTTAAGACTTTGGG 0: 69
1: 774
2: 2372
3: 2255
4: 1540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114917445 Original CRISPR AACATCAAGTCCAAGGTTCC AGG (reversed) Intergenic
No off target data available for this crispr