ID: 1114917448 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:27286122-27286144 |
Sequence | GTTGGAATGAGTTAAGACTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114917445_1114917448 | -3 | Left | 1114917445 | 14:27286102-27286124 | CCTGGAACCTTGGACTTGATGTT | No data | ||
Right | 1114917448 | 14:27286122-27286144 | GTTGGAATGAGTTAAGACTTTGG | No data | ||||
1114917447_1114917448 | -10 | Left | 1114917447 | 14:27286109-27286131 | CCTTGGACTTGATGTTGGAATGA | No data | ||
Right | 1114917448 | 14:27286122-27286144 | GTTGGAATGAGTTAAGACTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114917448 | Original CRISPR | GTTGGAATGAGTTAAGACTT TGG | Intergenic | ||