ID: 1114917451

View in Genome Browser
Species Human (GRCh38)
Location 14:27286125-27286147
Sequence GGAATGAGTTAAGACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114917447_1114917451 -7 Left 1114917447 14:27286109-27286131 CCTTGGACTTGATGTTGGAATGA No data
Right 1114917451 14:27286125-27286147 GGAATGAGTTAAGACTTTGGGGG No data
1114917445_1114917451 0 Left 1114917445 14:27286102-27286124 CCTGGAACCTTGGACTTGATGTT No data
Right 1114917451 14:27286125-27286147 GGAATGAGTTAAGACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114917451 Original CRISPR GGAATGAGTTAAGACTTTGG GGG Intergenic