ID: 1114917451 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:27286125-27286147 |
| Sequence | GGAATGAGTTAAGACTTTGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114917447_1114917451 | -7 | Left | 1114917447 | 14:27286109-27286131 | CCTTGGACTTGATGTTGGAATGA | No data | ||
| Right | 1114917451 | 14:27286125-27286147 | GGAATGAGTTAAGACTTTGGGGG | No data | ||||
| 1114917445_1114917451 | 0 | Left | 1114917445 | 14:27286102-27286124 | CCTGGAACCTTGGACTTGATGTT | No data | ||
| Right | 1114917451 | 14:27286125-27286147 | GGAATGAGTTAAGACTTTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114917451 | Original CRISPR | GGAATGAGTTAAGACTTTGG GGG | Intergenic | ||