ID: 1114918414

View in Genome Browser
Species Human (GRCh38)
Location 14:27296053-27296075
Sequence ATGTTGAAATGTTGGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114918414_1114918421 -9 Left 1114918414 14:27296053-27296075 CCCCTTTTCCAACATTTCAACAT No data
Right 1114918421 14:27296067-27296089 TTTCAACATGAAATTTGGTGGGG No data
1114918414_1114918420 -10 Left 1114918414 14:27296053-27296075 CCCCTTTTCCAACATTTCAACAT No data
Right 1114918420 14:27296066-27296088 ATTTCAACATGAAATTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114918414 Original CRISPR ATGTTGAAATGTTGGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr