ID: 1114919707

View in Genome Browser
Species Human (GRCh38)
Location 14:27311393-27311415
Sequence ATGCCCTTCTAGAATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114919707_1114919713 28 Left 1114919707 14:27311393-27311415 CCTGCAGCATTCTAGAAGGGCAT No data
Right 1114919713 14:27311444-27311466 AAGGTAAAGGAAGCAATGATTGG No data
1114919707_1114919708 2 Left 1114919707 14:27311393-27311415 CCTGCAGCATTCTAGAAGGGCAT No data
Right 1114919708 14:27311418-27311440 TTTGTTGCATCCTTTTTCCATGG No data
1114919707_1114919709 9 Left 1114919707 14:27311393-27311415 CCTGCAGCATTCTAGAAGGGCAT No data
Right 1114919709 14:27311425-27311447 CATCCTTTTTCCATGGTTTAAGG No data
1114919707_1114919711 15 Left 1114919707 14:27311393-27311415 CCTGCAGCATTCTAGAAGGGCAT No data
Right 1114919711 14:27311431-27311453 TTTTCCATGGTTTAAGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114919707 Original CRISPR ATGCCCTTCTAGAATGCTGC AGG (reversed) Intergenic
No off target data available for this crispr