ID: 1114919882

View in Genome Browser
Species Human (GRCh38)
Location 14:27312858-27312880
Sequence CAAAATGCACAAATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 3, 1: 8, 2: 107, 3: 179, 4: 570}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114919882_1114919884 10 Left 1114919882 14:27312858-27312880 CCTTGCTTCATTTGTGCATTTTG 0: 3
1: 8
2: 107
3: 179
4: 570
Right 1114919884 14:27312891-27312913 TGTTCACGACATCAAAAACCTGG No data
1114919882_1114919887 26 Left 1114919882 14:27312858-27312880 CCTTGCTTCATTTGTGCATTTTG 0: 3
1: 8
2: 107
3: 179
4: 570
Right 1114919887 14:27312907-27312929 AACCTGGACACAGCCGGGCACGG No data
1114919882_1114919886 21 Left 1114919882 14:27312858-27312880 CCTTGCTTCATTTGTGCATTTTG 0: 3
1: 8
2: 107
3: 179
4: 570
Right 1114919886 14:27312902-27312924 TCAAAAACCTGGACACAGCCGGG No data
1114919882_1114919888 27 Left 1114919882 14:27312858-27312880 CCTTGCTTCATTTGTGCATTTTG 0: 3
1: 8
2: 107
3: 179
4: 570
Right 1114919888 14:27312908-27312930 ACCTGGACACAGCCGGGCACGGG No data
1114919882_1114919885 20 Left 1114919882 14:27312858-27312880 CCTTGCTTCATTTGTGCATTTTG 0: 3
1: 8
2: 107
3: 179
4: 570
Right 1114919885 14:27312901-27312923 ATCAAAAACCTGGACACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114919882 Original CRISPR CAAAATGCACAAATGAAGCA AGG (reversed) Intergenic
900982499 1:6054304-6054326 CAAAACGCACATACAAAGCAAGG + Intronic
901252006 1:7785959-7785981 CAAAATGCAGTAATGAGGCTGGG + Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902541217 1:17156496-17156518 CAAAATGCACAAACAAAGCAAGG - Intergenic
903979961 1:27178648-27178670 CAAAACACACAAACAAAGCAAGG - Intergenic
905763110 1:40577226-40577248 CAAAACACACAAACAAAGCAAGG + Intergenic
906159364 1:43636389-43636411 AAGAATGGACAAATGAAGCTAGG - Intergenic
906247643 1:44288375-44288397 CAAGCTGTACAAATGTAGCAGGG + Intronic
907181247 1:52572248-52572270 CAAAACACACAAATAAAGCAAGG - Intergenic
907306166 1:53514245-53514267 CCAAATGCACAGATGAGGCAAGG + Intronic
907510644 1:54955841-54955863 CAAAACACACAAACAAAGCAAGG - Intergenic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908717863 1:67089128-67089150 CCAAATGCACACATCAACCAAGG + Intergenic
908934385 1:69357214-69357236 CAAAATGCACAAACAAAGCAAGG + Intergenic
909013942 1:70363553-70363575 CAAAACGCACAAACAAAGCAAGG - Intronic
909051295 1:70771859-70771881 CAAAACACACAAACAAAGCAAGG + Intergenic
909305564 1:74071567-74071589 CAAAAGACTCAAATGAAACAAGG - Intronic
909498136 1:76302823-76302845 CAAAACACACAAACAAAGCAAGG + Intronic
909824865 1:80115386-80115408 CAAAACGCACAAACGAAGCAAGG + Intergenic
910408189 1:86912756-86912778 CAAAAAGCATAAATGAGGCCAGG + Intronic
910809801 1:91224536-91224558 CAAAATGCACAAACAAAGCAAGG - Intergenic
911211394 1:95142462-95142484 CAAAATGCACAAAGCAAGGAAGG + Intronic
911474211 1:98356431-98356453 AAAAATGGGAAAATGAAGCAAGG - Intergenic
911734717 1:101324468-101324490 CAAAATGCACAAACAAAGCAAGG - Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912449442 1:109760209-109760231 CAAAAGGAACAAAGGAAGCCAGG - Intronic
913366292 1:118042888-118042910 CAAAATGCATAAACAAAGCAAGG - Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
914956351 1:152166203-152166225 CAAAATGCACAAACAAAGCAAGG + Intergenic
915208037 1:154285705-154285727 CTAAATGCACAAACAAAGCAAGG + Intergenic
915985016 1:160455878-160455900 CAATATGTACAAAGGAAGAAAGG - Intergenic
916028607 1:160856973-160856995 CAAAATGAACAACCCAAGCAAGG + Intronic
916255956 1:162788662-162788684 CAAAATGCACAAAGTAACAAAGG + Intergenic
916639993 1:166717486-166717508 CAAAATGTACAAACAAAGCAAGG - Intergenic
916792038 1:168133754-168133776 AAAAATACATAAATGAAGCTGGG - Intronic
916917976 1:169430675-169430697 AAAAACACACAAATAAAGCAAGG + Intronic
917497221 1:175551578-175551600 GAAATTGCACAAATGACACATGG + Intronic
917898989 1:179522926-179522948 GAAAATGCACAAATAAATTATGG - Intronic
918591476 1:186245748-186245770 CAAAATGCACAAAGTAACAAAGG - Intergenic
918629861 1:186703614-186703636 CAAAATGCACAAACAAACCTAGG - Intergenic
918932162 1:190868417-190868439 CACAATGCAAAATTGAAGGAAGG - Intergenic
919648524 1:200121660-200121682 CAAAATACAGAAATCAAGTAAGG - Intronic
919710275 1:200720586-200720608 CAAAATGCATAAACAAATCATGG + Intergenic
920684524 1:208099262-208099284 CAAAACGCACAAACAAAGCAAGG + Intronic
921663767 1:217841153-217841175 CAATATGCAGAAATGAAGTAAGG + Intronic
922273819 1:224058136-224058158 CAAAACGCACAAAGCAAGGAAGG + Intergenic
923246169 1:232134727-232134749 CAAAACGCACAAACAAAGCAAGG - Intergenic
923317103 1:232791457-232791479 CAAAATGTAAAAATGTATCATGG - Intergenic
923644001 1:235796689-235796711 CAAAATGCAGAAAGGAAGAGAGG - Intronic
923878721 1:238079325-238079347 CAAAAACCAGAAATGAAGGAAGG - Intergenic
923943948 1:238861675-238861697 CAAAACGCACAAACAAAACAAGG + Intergenic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924297220 1:242599586-242599608 CAAAACGCACAAACAAAGCAAGG - Intergenic
924928753 1:248708792-248708814 CAAAATGCACAAAGTAACAAAGG + Intergenic
924930586 1:248728763-248728785 AAAAATGCATAAACAAAGCAAGG + Intronic
1063112828 10:3051806-3051828 CACAACGCACAAATGGAGCAAGG + Intergenic
1063192830 10:3713863-3713885 CAAAATGCAGCAATAAACCAAGG + Intergenic
1063856136 10:10256226-10256248 TAAAATGCACACATAAAGCATGG - Intergenic
1064352018 10:14585215-14585237 CAAAACGCACAAACAAAGCAAGG - Intronic
1064408382 10:15084469-15084491 CAAAATGCACAAACAAAGCAAGG + Intronic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1064765352 10:18664848-18664870 CATAGTGCAAAAGTGAAGCAAGG + Intronic
1065095619 10:22278072-22278094 CAAAACGCACAAACAAAACAAGG + Intergenic
1065428510 10:25630463-25630485 CAAAATGCACAAAGCAAGCAAGG - Intergenic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1065768163 10:29051569-29051591 AAAAATTCACAAGTGAAGTAGGG + Intergenic
1065780070 10:29159142-29159164 CAAAACGCACAAACAAAGCAAGG + Intergenic
1065781615 10:29174259-29174281 CAAAACACACACACGAAGCAAGG + Intergenic
1065850236 10:29781706-29781728 CAAAATGCACAAACAAAGCAAGG + Intergenic
1066260027 10:33720436-33720458 CAAAATGCATAAACAAAGCAAGG - Intergenic
1066722419 10:38354314-38354336 CAAAATGCACAAAGTAACAAAGG + Intergenic
1066814577 10:39389082-39389104 CAAAATGCTCAAAAAAAGAAAGG + Intergenic
1067823758 10:49554027-49554049 AACAATGCCCAAATTAAGCAGGG - Intergenic
1068077856 10:52279576-52279598 CAAAATTCATAAGTGAATCAAGG - Intronic
1068428485 10:56899784-56899806 TAAAATGCAGAAAGGAAGCAGGG - Intergenic
1068938919 10:62661937-62661959 CAAAATGCACAAACAAAGCAAGG + Intronic
1069214202 10:65799010-65799032 CAAAACACACAAACAAAGCAAGG + Intergenic
1069809769 10:71149666-71149688 GAACAAGGACAAATGAAGCAAGG + Intergenic
1069945758 10:71984396-71984418 CAAAACGCACAAAGCAAGGAAGG - Intronic
1071194507 10:83142214-83142236 CAAAACCCACACATGAAGGAGGG - Intergenic
1071546341 10:86532649-86532671 CAAAACGCACAAACAAAGCAAGG - Intergenic
1071926466 10:90415459-90415481 CAGCTTGCACACATGAAGCAGGG - Intergenic
1072112001 10:92331281-92331303 GAAAAAGCACAACTGAATCAAGG - Intronic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1072518051 10:96205835-96205857 CAAAATCCAGGAAAGAAGCAGGG - Intronic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1072921163 10:99578461-99578483 CAAAACGCACAAACAAAGCGAGG - Intergenic
1073180858 10:101582301-101582323 CAAAATGCACAAATGTGCAAAGG - Intronic
1073191364 10:101652636-101652658 CAAAATGCTAAAATCAAGCAAGG + Intronic
1073554673 10:104437500-104437522 CACAATGCAAATATGATGCAAGG + Intronic
1073822048 10:107275122-107275144 CAAAATGCACAAACCAAGCAAGG + Intergenic
1074594831 10:114852574-114852596 CAAAAAGCAAAAATGGAGAAGGG - Intronic
1075603090 10:123785161-123785183 CAAAATGCACAAACAAAGCAAGG - Intronic
1075889041 10:125929711-125929733 CAAAACGCACAAAGCAAGGAAGG + Intronic
1075914578 10:126156581-126156603 CAAAATGCACAAACAAAACAAGG - Intronic
1076107170 10:127832776-127832798 CAAAACGCACAAACAAAGCAAGG - Intergenic
1076181563 10:128413013-128413035 CAAAACACACAAACAAAGCAAGG - Intergenic
1076348652 10:129799238-129799260 CAGGAAGCATAAATGAAGCAGGG + Intergenic
1076653785 10:132007836-132007858 CAACACGCACAAACAAAGCAAGG - Intergenic
1076879524 10:133233084-133233106 AAAAATGCAAAAATTAGGCATGG + Intergenic
1076908315 10:133374101-133374123 CAAAACGCACAAACAAAGCACGG + Intergenic
1077005406 11:353039-353061 CAAAACCCACAAAGGAAGGAAGG - Intergenic
1077262981 11:1632891-1632913 CAAAACGCACAAATAAAGCGAGG + Intergenic
1077827263 11:5824717-5824739 CAAAATGCACAAACAAAGCAAGG - Intronic
1078396309 11:10984922-10984944 GCAAATGAACAAGTGAAGCATGG + Intergenic
1078499640 11:11858173-11858195 CAAAATGTACAAAAGAAGCAAGG - Intronic
1078801825 11:14653374-14653396 AAAAATCCACAAATCAGGCAAGG + Intronic
1079410540 11:20183287-20183309 CAAAATACACATTTGAGGCACGG - Intergenic
1079742132 11:24076076-24076098 GAAAATGCAAAAACAAAGCAAGG + Intergenic
1079757892 11:24288617-24288639 CAAAATGCATACAGGAACCATGG + Intergenic
1079900111 11:26172619-26172641 CAACATACACAAATCAAGAAAGG + Intergenic
1080611717 11:33910063-33910085 CAAAACGGTCAAATGAGGCAAGG + Intergenic
1081013186 11:37841776-37841798 CAAAACACACAAACAAAGCAAGG - Intergenic
1081531378 11:43962014-43962036 CAAAATGCACAAAGTAAGAAGGG - Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1082778023 11:57262951-57262973 CAAAATGCACAAACAAAGCAAGG - Intergenic
1083911124 11:65710751-65710773 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1084246121 11:67858364-67858386 AAAAATGCAAAAATTAGGCATGG + Intergenic
1084826552 11:71736136-71736158 AAAAATGCAAAAATTAGGCATGG - Intergenic
1085148160 11:74222782-74222804 CAAAATGCCCAAATCGAGCTGGG - Intronic
1085240287 11:75047570-75047592 CAAAACACACAAACAAAGCAGGG - Intergenic
1085480603 11:76819903-76819925 CAAAACACACAAACAAAGCAAGG + Intergenic
1085914624 11:80870465-80870487 TAAAATGGACTAATGAAGAAAGG + Intergenic
1085929345 11:81062349-81062371 CAAGATGTACAAACAAAGCAAGG - Intergenic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086024116 11:82269364-82269386 CAAGATGCACAAATGAACAAAGG + Intergenic
1086069348 11:82782562-82782584 CAAAATGCGCAAACAAAGCAAGG - Intergenic
1086572490 11:88301511-88301533 CAAAACTCACAAATGAGGCAAGG - Intronic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087464583 11:98488935-98488957 CAAAAGGCACAAACAAAGCAAGG + Intergenic
1087465253 11:98495728-98495750 CAAAATGCACAAACAAATCGAGG + Intergenic
1087805407 11:102550165-102550187 CAAAATTAACAATAGAAGCATGG - Intergenic
1089142412 11:116296571-116296593 CAAAATGTATAAACAAAGCAAGG - Intergenic
1092251458 12:6900491-6900513 CAAAACACACAAACAAAGCAAGG + Intronic
1092486581 12:8907502-8907524 CAAAATGCACAAACAAAGCAAGG + Intergenic
1092504533 12:9082608-9082630 TCAAATGCACAAATAATGCAAGG + Intronic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1092853474 12:12651588-12651610 CAAAACGCACAAACAAAGCAAGG + Intergenic
1093071767 12:14713236-14713258 CAAAATGCACAAACAAAGCAAGG - Intergenic
1093108091 12:15113931-15113953 CAGAATGCACAAATTTACCAAGG + Intronic
1093327445 12:17795203-17795225 CAAAATACGCAAATGAAAGATGG + Intergenic
1093707086 12:22286454-22286476 AAAAATTCAGAAATGAATCATGG - Intronic
1093914859 12:24790113-24790135 AAACATGTACACATGAAGCATGG + Intergenic
1094308850 12:29054743-29054765 CAAATTGTACAATTCAAGCATGG + Intergenic
1095180057 12:39137260-39137282 CAAAATGCACAAACAAAGCAAGG + Intergenic
1095215069 12:39538505-39538527 CAAAATGCACAAACAAAGCAAGG - Intergenic
1095852519 12:46826246-46826268 TAAAATGAATAAATGACGCAAGG + Intronic
1096970926 12:55665718-55665740 CAAAATGCACAAACAAAGCAAGG + Intergenic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1098135472 12:67397312-67397334 CAAAACACACAAACAAAGCAAGG + Intergenic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098313291 12:69168780-69168802 CAAAACACACAAATAAAGCAAGG - Intergenic
1098313363 12:69169487-69169509 ACAAATGCACAAACAAAGCAAGG - Intergenic
1098497026 12:71148184-71148206 AAAAATGGATAATTGAAGCATGG - Intronic
1098695704 12:73551646-73551668 CAAAATGCACAAACAAAGCAAGG + Intergenic
1099084779 12:78232065-78232087 CAAAACTCACAAACAAAGCAAGG - Intergenic
1099398980 12:82178888-82178910 CAAAAAGCACAAACAAAGCAAGG - Intergenic
1099448884 12:82784725-82784747 CCAAATACAAAAATGAAGCATGG - Intronic
1100572611 12:95857536-95857558 CAAAACGCACAAACAAAGCAGGG - Intergenic
1100634374 12:96421154-96421176 CAAAACGCACAAACAAAGCAAGG + Intergenic
1101313480 12:103607355-103607377 CAAAAAACCAAAATGAAGCATGG - Intronic
1101571109 12:105954542-105954564 CAAAATCCACAATAGAGGCATGG - Intergenic
1101705776 12:107219715-107219737 CCAAATGCACAACTGAAGAATGG - Intergenic
1102053854 12:109881610-109881632 GAAAACACACAAACGAAGCAAGG - Intergenic
1102373806 12:112404627-112404649 TAAAATGCACAAATCTGGCAGGG + Intergenic
1102506991 12:113389999-113390021 GAAAATGGACAAATGAGGCCAGG - Exonic
1103755981 12:123207555-123207577 CAAAATACAGAAATGAAGGCCGG + Intronic
1103943723 12:124514685-124514707 CAAAATACAAAAATTAGGCATGG + Intronic
1104169889 12:126269907-126269929 GAAAAGGCAAAAATGAAGAAAGG - Intergenic
1104489509 12:129181829-129181851 GAAAATGGACAAATAAAGGATGG - Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1105364977 13:19756328-19756350 CAAAATGCTCAAAGCAAGGAAGG - Intronic
1105404269 13:20120386-20120408 CAAAACGCACAAACAAAGCAAGG + Intergenic
1106012549 13:25838603-25838625 CAAAATGAACATTTAAAGCAGGG + Intronic
1106278616 13:28241099-28241121 AAAAATACACAAATGAGCCAGGG + Intronic
1106598977 13:31171162-31171184 CAAAATGCACAAACAAAACAAGG - Intergenic
1106601602 13:31192289-31192311 CAAAACGCACAAATAAAGCAAGG - Intergenic
1106674360 13:31942171-31942193 CAAAATCCACAAGGAAAGCATGG + Intergenic
1107111309 13:36701061-36701083 CAAAATGCACAAACAAAGCAAGG + Intergenic
1107417038 13:40210378-40210400 TAACATGGACAAATGAGGCATGG + Intergenic
1107530504 13:41278287-41278309 CAAAATGCACAAACAAAGCAAGG + Intergenic
1107568077 13:41627339-41627361 CAAAACACACAAACAAAGCAAGG - Intronic
1108432145 13:50364998-50365020 TACAATGAAGAAATGAAGCAAGG - Intronic
1108503224 13:51086738-51086760 CAAAATCCACTAAGGATGCAAGG - Intergenic
1108669299 13:52667503-52667525 AAAAATACAAAAATTAAGCAGGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108706619 13:52994343-52994365 CCAAATCAACAAATGAAGCCTGG - Intergenic
1108997301 13:56749844-56749866 GAAAATGAACACATTAAGCAAGG - Intergenic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1109488357 13:63058385-63058407 CAAAATGCACAAACAAAGCAAGG - Intergenic
1109510160 13:63361490-63361512 CAAAACGCACAAACAAAGCAAGG - Intergenic
1109783091 13:67138721-67138743 CAAAATGCACAAACAAAGCAAGG - Intronic
1109928666 13:69183540-69183562 CAAAATGCACAAAGAAAGAAAGG - Intergenic
1109964220 13:69670567-69670589 CAAAATACACAAATCAATAAAGG + Intergenic
1110418067 13:75273804-75273826 CAAAATGCACAAACAAAGCAAGG + Intergenic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1111228666 13:85311255-85311277 CAAAATGAAGAAATGAAAAAAGG + Intergenic
1111594764 13:90397025-90397047 CAAAATGCACAAACAAAGCAAGG - Intergenic
1111742390 13:92219978-92220000 CAAAAAGCACAAACAAAGCAAGG - Intronic
1111936192 13:94559185-94559207 CAAAACGCACAAAGTAAGAAAGG - Intergenic
1112370528 13:98789093-98789115 CAAAACGCACAAACAAAGCAAGG - Intergenic
1112374391 13:98825268-98825290 CAAAATGATCAAGTGAAGAAGGG + Intronic
1112404274 13:99104389-99104411 CAAAATGCACAAACAAAGCAAGG + Intergenic
1112903837 13:104392499-104392521 CAAAAACCACAATTGAAGTATGG - Intergenic
1114326612 14:21595392-21595414 CAAAATACACAAATTAGGCTGGG + Intergenic
1114912059 14:27213132-27213154 CAAAATGCGCAAGCAAAGCAAGG + Intergenic
1114912760 14:27220785-27220807 CAAAACGCACAAACAAAGCTGGG + Intergenic
1114919260 14:27306545-27306567 CAAAACGCACCAACAAAGCAAGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115531957 14:34335877-34335899 CGAAATGCACAAACAAAGCAAGG + Intronic
1115543124 14:34441489-34441511 CAAAATGCATAAACAAAGCAAGG - Intronic
1115544026 14:34448711-34448733 CAAAACGCACAAACAAAGCGAGG - Intronic
1116370823 14:44128992-44129014 CAAAATCCATAAAGGAAGAAAGG + Intergenic
1116397303 14:44462093-44462115 CAAAACACACAAACAAAGCAAGG - Intergenic
1116508176 14:45711437-45711459 AAAAATTCACAAATTAAGAATGG - Intergenic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1116577180 14:46588783-46588805 CAAAATGCACAAAGTAAGGAAGG + Intergenic
1116726510 14:48566972-48566994 CAAAATGCACACATAAAGCAAGG + Intergenic
1116929969 14:50680852-50680874 CAACATACACAAATCAAACATGG - Intergenic
1117040420 14:51764091-51764113 CAAAATGCAGACATGATGCTGGG - Intergenic
1117146032 14:52837573-52837595 CAAAACGCACAAACAAAGCCAGG - Intergenic
1117406287 14:55407422-55407444 AAAAATGCAAAAATGAGGCCGGG - Intronic
1118281255 14:64430773-64430795 GCAAATGACCAAATGAAGCATGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119049444 14:71352153-71352175 CAGAAAGCACAAATGTACCATGG + Intronic
1119676750 14:76561535-76561557 CAAAAGGCACAAACAAAGCAAGG + Intergenic
1120047213 14:79821009-79821031 CAAAATGAAGAGATGATGCAAGG + Intronic
1120231990 14:81850078-81850100 CAAAATGCACAAACAAAGCCAGG + Intergenic
1120232646 14:81856636-81856658 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1120431517 14:84422583-84422605 AAATATGCAGAAAAGAAGCATGG - Intergenic
1120465303 14:84848989-84849011 AAAACTGCACAAATGATGAAAGG - Intergenic
1120484926 14:85101505-85101527 AAAAATGAACAAATGAAACAAGG - Intergenic
1120880994 14:89415457-89415479 CAAAACGCACACATGATCCAAGG - Intronic
1121267914 14:92616222-92616244 CAAAATGCACAAAGCAAGGAAGG + Intronic
1122182672 14:99967365-99967387 CAAAACACACAAACAAAGCAAGG - Intergenic
1122398984 14:101456315-101456337 CAAAATCCACAAATCCAACAGGG + Intergenic
1122439634 14:101721470-101721492 CAAAACGCACAAACAAAGCAGGG - Intergenic
1122654279 14:103246937-103246959 CAAAACGCACAAACAAAGCAAGG - Intergenic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1125630484 15:41143128-41143150 CAAAACGCACAAACAAAGCAAGG + Intergenic
1126183937 15:45812121-45812143 CAAAATGCACAAACAAAGCAAGG + Intergenic
1126389124 15:48126825-48126847 CTAAATTCACAAACTAAGCAAGG - Intronic
1127724789 15:61738759-61738781 CAAAATGCTTCAATGATGCATGG + Intergenic
1127773655 15:62249701-62249723 CAAAATGCACAAACAAAGCGAGG - Intergenic
1128190345 15:65688026-65688048 CAAAAGGAACAAATGAAATATGG - Intronic
1128283652 15:66418008-66418030 CAAAATGCACAAAGCAAGGAAGG + Intronic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129040717 15:72684124-72684146 CAAAATGCACAAACAAAGCAAGG + Intronic
1129063096 15:72876778-72876800 CAAAATGCACAAACAAAGCAAGG - Intergenic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1129258771 15:74350834-74350856 CAAAACGCACAAACAAAGCACGG - Intronic
1129260481 15:74364616-74364638 CAAAATGCACAGACAAAGTAAGG - Intronic
1129506566 15:76086481-76086503 CAAAATGCACAAACAAAGCAAGG + Intronic
1129638713 15:77351657-77351679 CAAAACGCACAAACAAAGCAAGG - Intronic
1130193750 15:81760371-81760393 CAAAATGCACATTCAAAGCAAGG - Intergenic
1130312067 15:82764783-82764805 CAAAATGCACAAACAAAGCAAGG - Intronic
1130485865 15:84398231-84398253 CCATATACAAAAATGAAGCAGGG - Intergenic
1131644481 15:94327005-94327027 CAGAATGAACAAGTGATGCATGG - Intronic
1132278580 15:100592280-100592302 AAGAAAGCACAAACGAAGCAAGG - Intronic
1132610661 16:814344-814366 TAAAATGCAAAAATGTAGCCAGG + Intergenic
1132752105 16:1462858-1462880 CCACATGCAAAAATGAAGCTGGG + Intronic
1132783100 16:1639256-1639278 CAAAATGCACAAACAAAGCAAGG + Intronic
1132785266 16:1653514-1653536 TAAAATGTACAAATGAAAAAGGG - Intronic
1132937570 16:2489134-2489156 CAAAATGAATGAATGAGGCATGG + Intronic
1133514731 16:6497486-6497508 CAAAATGCCGCAATGGAGCAAGG + Intronic
1133772851 16:8877750-8877772 CAAAATACACAAATTTAGCCAGG + Intergenic
1133998772 16:10766662-10766684 CAAAACGCACAAAGAAAGGAAGG + Exonic
1134582693 16:15384497-15384519 AAAAATGCAAAAATTAAGCTGGG - Intergenic
1134854769 16:17509151-17509173 TGAAATGCACAAACAAAGCAAGG - Intergenic
1135742461 16:24987789-24987811 TAAAATGAAAAAATGAAGCATGG + Intronic
1135754773 16:25087824-25087846 TAAAATGAAAAAATGAAGCATGG + Intergenic
1135788670 16:25373561-25373583 CAAAATGCACAAACAAAGCAAGG + Intergenic
1137240269 16:46650002-46650024 CAAAACGCACAAACAAAGCAAGG + Intergenic
1137859768 16:51834768-51834790 CAAAATGCCAAGATGAACCAGGG - Intergenic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1139642086 16:68299037-68299059 CATAATGCATATGTGAAGCATGG + Exonic
1139858365 16:69999646-69999668 GAAAATGCAAAAATTAAGCCGGG - Intergenic
1140034041 16:71359412-71359434 GAAAATGGACAAAGGAAGCAGGG - Intronic
1140043904 16:71426932-71426954 TAAAATCCACAAATGAGGCCGGG + Intergenic
1140115044 16:72034608-72034630 CAAAATGCACAAACAGAGCAAGG - Intergenic
1140830226 16:78743993-78744015 CAAAACGCATAAACAAAGCAAGG - Intronic
1140946589 16:79774077-79774099 AAAAATGCACAAATTATACAAGG - Intergenic
1141234007 16:82198687-82198709 CCAAGAGCACAGATGAAGCAAGG + Intergenic
1141417024 16:83883610-83883632 CAAAATGCATAAATAAAGCATGG - Intergenic
1142649105 17:1335163-1335185 CAAAACGCACAAAGCAAGCAAGG - Intergenic
1142840029 17:2621520-2621542 CCAGATGCAGCAATGAAGCAAGG - Intronic
1143262850 17:5613233-5613255 CAAAATGCCCAAGTGAATCCAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144748170 17:17629782-17629804 AAAAATGCAAAAATTTAGCAGGG - Intergenic
1145225558 17:21125220-21125242 CAAAACGCACAAACAAAGCAAGG + Intronic
1145354466 17:22128804-22128826 CAAAATGCACAAACAAAGCTAGG + Intergenic
1145831438 17:27919680-27919702 AAAAATGCAAAAATTAGGCAGGG + Intergenic
1146040151 17:29445201-29445223 CAATAAGCACATATGAAGAATGG + Intronic
1146993292 17:37295435-37295457 CAAAACACACAAACAAAGCAGGG + Intronic
1147035127 17:37674085-37674107 AAAAATACAAAAATGAGGCATGG + Intergenic
1147955911 17:44134366-44134388 CAACATGGCCACATGAAGCAGGG + Intergenic
1148608282 17:48946413-48946435 CAAAACGCACAAACAAAGCAAGG + Intergenic
1149271249 17:54980422-54980444 CAAAATGCACAAACAAAGCAAGG + Intronic
1149471279 17:56916969-56916991 CAAAAAACACAAAAGAAACAAGG - Intergenic
1149476261 17:56963524-56963546 CAAAACGCACAAACAAAGCAAGG - Intergenic
1149841565 17:59969531-59969553 GAAAATGCATAAATGAGGAATGG - Intronic
1150857048 17:68763284-68763306 CAATATGTAAAAATGAAGCCTGG + Intergenic
1151797698 17:76357478-76357500 CAAAACGCACAAACAAAGCAAGG - Intronic
1152343809 17:79739542-79739564 GAAAATGCAAAAATGAAAGATGG + Intronic
1152367778 17:79866646-79866668 AAAAATACACAAATTAAGCCAGG - Intergenic
1152967090 18:126421-126443 CAAAATACAAAAAAGTAGCAAGG + Intergenic
1153168779 18:2292162-2292184 CAAAATGCACAAACAAAGCAAGG - Intergenic
1153261739 18:3230836-3230858 CAAAATGCACAAACAAAGCAAGG - Intergenic
1153539323 18:6136803-6136825 CAAAACACACAAACAAAGCAAGG - Intronic
1153721684 18:7910346-7910368 CAAAACGCACAAACAAAGCAAGG + Intronic
1153832172 18:8933535-8933557 CAAAACACACAAACAAAGCAAGG - Intergenic
1154113076 18:11586973-11586995 CAAAATGCACAAACAAAGCAAGG - Intergenic
1154335464 18:13461483-13461505 CAAAACACACAAACAAAGCAAGG + Intronic
1154361894 18:13669869-13669891 CAAAGTCCCCAAATGAAGTATGG - Intronic
1154926900 18:20945631-20945653 CAAAATACAAAAAAGTAGCAAGG - Intergenic
1155517012 18:26634210-26634232 CAAAATGGGAAAATGAATCATGG + Intronic
1155803268 18:30135869-30135891 CAAAATGCACAAACAAAGCAAGG + Intergenic
1155917793 18:31573079-31573101 AAAGATACAGAAATGAAGCAGGG - Intergenic
1155944454 18:31832821-31832843 TAACATGTACAAATGAAGCAGGG + Intronic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156132259 18:33990489-33990511 CAAACTGCACAAATAAGGCAGGG - Intronic
1156238369 18:35227123-35227145 CAAAATGCACAAACAAAGCAAGG + Intergenic
1156849304 18:41707773-41707795 AAAAACGCACAAACAAAGCAAGG + Intergenic
1157013152 18:43677429-43677451 CAAAACGCACAAAGGAAGGATGG + Intergenic
1157013739 18:43683325-43683347 CAAAATGCACAAACAAAGCAAGG + Intergenic
1157726646 18:49969565-49969587 CAAAACGCACAAAGCAAGGAAGG - Intronic
1157775964 18:50396579-50396601 CAAAATGCACAAAGCAAGGAAGG - Intergenic
1157789625 18:50520136-50520158 AGAAACGCACAAAGGAAGCAAGG + Intergenic
1158597435 18:58828378-58828400 CAAAACGCAAAAACAAAGCAAGG - Intergenic
1158625989 18:59072063-59072085 CAAAATGCACAAACAAAGCAAGG - Intergenic
1158631654 18:59120502-59120524 CAAAATTTACAAATTAAGGAAGG - Intergenic
1158654926 18:59321960-59321982 CAAAACGCACAAACAAAGCCAGG - Intergenic
1158694015 18:59687104-59687126 GAAAATTCCAAAATGAAGCAAGG + Intronic
1158847638 18:61461639-61461661 CAAAATGCACAAACAAAGCGAGG + Intronic
1159289166 18:66394279-66394301 CAAGATACAAGAATGAAGCATGG - Intergenic
1159408044 18:68032126-68032148 GAAAAGGCAGACATGAAGCAAGG - Intergenic
1159604051 18:70456798-70456820 CAAAACGCACAAACAAAGCAAGG - Intergenic
1160263187 18:77314941-77314963 CAAAACACACAAACAAAGCAAGG + Intergenic
1162657053 19:12139363-12139385 CAAAACGCACAAAGCAAGGAAGG - Intronic
1163036142 19:14570190-14570212 CAAAATACAAAAATTAAGCCGGG - Intronic
1163590624 19:18192220-18192242 CAAAGTGCACAAACAAAGCAAGG - Intergenic
1164064306 19:21702087-21702109 AAAAATACAAAAATCAAGCATGG + Intergenic
1164818339 19:31224307-31224329 CACAAAGCACAAATTAACCATGG - Intergenic
1164995587 19:32718846-32718868 CAAAAGGCACACACAAAGCAAGG - Intergenic
1165122804 19:33572816-33572838 CAAAATGCAGAAACAAAGCAAGG + Intergenic
1166030555 19:40122777-40122799 CAAAACCCCCAAATCAAGCAAGG - Intergenic
1166713160 19:44950027-44950049 CAAAACGCACAAACAAAGCAAGG + Exonic
1167871369 19:52373272-52373294 CAAAATGCAAAAATACACCAGGG - Intronic
1167987058 19:53327552-53327574 CAAAATGCATAAATTAAGGAAGG + Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925331432 2:3061846-3061868 CATAATGCATAAATGATGTAAGG - Intergenic
925770466 2:7277476-7277498 CAAAAGGCACAAATGCAGAGTGG - Intergenic
926309793 2:11667196-11667218 CAAAATAAAAAATTGAAGCAAGG - Intronic
926382196 2:12301860-12301882 CAAAATAGATAAATGAAGAAGGG + Intergenic
927411122 2:22827754-22827776 CAAAAAGCAGAAATGTAGAATGG + Intergenic
927649604 2:24904107-24904129 CAAAATGCAAAAAGGAAGGAAGG + Intronic
927675771 2:25104928-25104950 TTAAATGCACACAAGAAGCAGGG - Intronic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930364246 2:50419034-50419056 CAAAATACACAATTGAGGAAGGG + Intronic
930631038 2:53755700-53755722 CATAATGCACACAAGATGCATGG + Intronic
930648300 2:53936228-53936250 CAAAAAGAACAAATGGAGGAGGG - Intronic
930951729 2:57150723-57150745 CAAAATACACAAATCAATAAAGG + Intergenic
931412152 2:62042788-62042810 CAAAATGCACAAAAGAGGCCGGG - Intronic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
931857667 2:66320070-66320092 AAAAATAAACAAATGAAACAAGG + Intergenic
932010893 2:67976468-67976490 CAAAGTGCAGAAATGAGACATGG + Intergenic
932358302 2:71084989-71085011 CAAAATGCACAAACAAAGCAAGG - Intergenic
933367901 2:81377437-81377459 AATAATGCTCAAATGATGCACGG + Intergenic
933562633 2:83907621-83907643 CAAAATGCACAAAGTAACAAAGG + Intergenic
933660690 2:84925209-84925231 CAAAATGCACAAACAAAGCAAGG - Intergenic
934818548 2:97351825-97351847 CAAAATGCACAAACAAAGCAAGG - Intergenic
934899698 2:98149294-98149316 CAAAACTCACAAACAAAGCAAGG + Intronic
935227443 2:101065456-101065478 CAAAAATTACAAATGAAGGAGGG + Intronic
935301740 2:101698406-101698428 AAAAATGAATAAATCAAGCAAGG - Intronic
935309236 2:101766836-101766858 CAAAATGCACAAACAAAGCAAGG + Intronic
935460692 2:103329704-103329726 CTAAATGCAAAAACAAAGCAAGG - Intergenic
935514191 2:104015435-104015457 CAAAATCCACAAATGACAAAAGG - Intergenic
935572339 2:104675214-104675236 AAAAATACACAAATAACGCAAGG - Intergenic
937634048 2:124135749-124135771 CCAAATGAACAAACGAAGCCTGG - Intronic
937714319 2:125014275-125014297 CACAGTGCACAAAGGCAGCAAGG - Intergenic
937847638 2:126599100-126599122 CAAAAGGAAAAAATGAACCAAGG + Intergenic
938236180 2:129708849-129708871 CAAAATGCACAAACAAAGCAAGG + Intergenic
938410389 2:131059036-131059058 AGAAATGCAAAAAGGAAGCATGG + Intronic
938470210 2:131553136-131553158 AAAAATGCACCAAAGAAGCTGGG - Intergenic
938802905 2:134779157-134779179 CACAATGCACAAACAAAGCAAGG + Intergenic
939265800 2:139871448-139871470 CAAAAAGTACAGATGAAGTAAGG - Intergenic
939426453 2:142044201-142044223 TTTAATGCACAAATAAAGCAAGG - Intronic
939863502 2:147446268-147446290 CAAAATACGCAAACAAAGCAAGG + Intergenic
940293968 2:152103308-152103330 AAAAATGGACAAAAGTAGCAGGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940568775 2:155404229-155404251 CAAAATGCACAAACAAAACAAGG - Intergenic
940569443 2:155411349-155411371 CAAAATGCACAAACAAAGCAAGG - Intergenic
940707972 2:157127254-157127276 CAAAACACACAAACAAAGCAAGG - Intergenic
942256381 2:174103713-174103735 CAAAATGAACAAAACATGCATGG + Intronic
942756135 2:179343703-179343725 CAAAACGCACAAAGCAAGGAAGG + Intergenic
943083603 2:183285313-183285335 CAAAATGCACAAGTGTAACCAGG - Intergenic
943293610 2:186108711-186108733 CAAAAGGCACAAATGACCCCTGG - Intergenic
943693694 2:190898063-190898085 AAAAATGCACGAATAAAGAAAGG - Intronic
943743542 2:191437406-191437428 CAAAACGCACAAACAAAGCAAGG + Intergenic
944485806 2:200203961-200203983 CAAAATGCACAAACAAAGTGAGG - Intergenic
944590092 2:201208976-201208998 CAAAATGAAGAACTGAAACAAGG - Intronic
945075831 2:206038670-206038692 CAAAATGCAAAAATATAGCCAGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945922204 2:215766422-215766444 CAAAAGGCAAAAATAAAGAAGGG + Intergenic
946535224 2:220620289-220620311 CAAAATGAAGATGTGAAGCAGGG - Intergenic
946783725 2:223220484-223220506 CATAAAGCTGAAATGAAGCATGG - Intergenic
946929766 2:224660090-224660112 CAAAACGTACAAACAAAGCAAGG - Intergenic
947184368 2:227441908-227441930 AAAAATACACAAATTAGGCATGG - Intergenic
947195522 2:227562201-227562223 AAAAATACAAAAATGAGGCATGG + Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947539981 2:230969707-230969729 CAAAACCCACAAACAAAGCAAGG - Intergenic
947782841 2:232785142-232785164 CAAAATGGACTAATAAACCAAGG + Intronic
947961667 2:234243914-234243936 CAAAATGCACTAAGAAAACAAGG + Intergenic
948007542 2:234622725-234622747 CAAAATGCATAAACAAAGCAAGG - Intergenic
948154858 2:235773053-235773075 CAAAATGCACAAACAAAGCAAGG + Intronic
948272307 2:236683898-236683920 CAAAATGCACAAACAAAGCAAGG + Intergenic
1168898979 20:1343799-1343821 CAAAACGCTCAAACAAAGCAAGG + Intronic
1169789239 20:9392213-9392235 CAAAATGCACAAACAAAGCAAGG + Intronic
1170875800 20:20248875-20248897 CAAAAAGCAAAAATGGAGGACGG - Intronic
1170896483 20:20419562-20419584 CAAAAAGCTCAAATCAAACATGG + Intronic
1171101985 20:22393063-22393085 CAAAATGAACAATTAATGCATGG - Intergenic
1172175889 20:32971542-32971564 CAAAATACACAAACAAAGCAAGG - Intergenic
1172334917 20:34107288-34107310 CAAAATGCTGAATTTAAGCATGG - Intronic
1172343877 20:34181483-34181505 CAAAATGCACAAACAAAGCAAGG + Intergenic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1172975548 20:38903258-38903280 CAAGATGGACACATGAAGCCTGG - Intronic
1173275308 20:41575268-41575290 CAAAATGTACAAACAAAGCAAGG - Intronic
1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG + Intergenic
1174448653 20:50607080-50607102 CAAAATGCAGAAAAGGAGCAGGG - Intronic
1174532585 20:51225744-51225766 CAAAACGCACAAACAAAGCAAGG + Intergenic
1174680285 20:52399914-52399936 GACAATGCAGAAAAGAAGCATGG - Intergenic
1174736560 20:52971500-52971522 CAAAATGGAGAAATGGGGCAGGG + Intergenic
1175009586 20:55721740-55721762 CAAAAAGCACAAAGAAAGAAAGG - Intergenic
1175057415 20:56210829-56210851 CAAAACACACAAACAAAGCATGG + Intergenic
1175254612 20:57632948-57632970 CAAATTGCCCAAATAAAACATGG + Intergenic
1175396502 20:58667030-58667052 CAAAATGCTCAATAGTAGCAAGG - Intronic
1177533594 21:22396520-22396542 CAAAACGCACAAAGCAAGGAAGG - Intergenic
1177534272 21:22403478-22403500 CAAAACACACAAACAAAGCAAGG - Intergenic
1177742886 21:25175163-25175185 GAACATGTATAAATGAAGCAAGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1180133907 21:45848108-45848130 CAAAACGCACAAACAAAGCAAGG + Intronic
1180134492 21:45853404-45853426 CAAAACACACAAACAAAGCAAGG + Intronic
1180212558 21:46303424-46303446 CAAAATGCACATATCAAAAAAGG + Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181625969 22:24122410-24122432 CAAAATGCTCCAATGAGGCTGGG + Intronic
1182649719 22:31841419-31841441 CAAAATGCACAAACAAAGCAAGG + Intronic
1183396426 22:37573884-37573906 AAAAATGCAAAAATTAGGCATGG - Intronic
1184022067 22:41827463-41827485 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1184168869 22:42746969-42746991 CAAAATGCACAAACAAAGCAAGG - Intergenic
1184297757 22:43536359-43536381 TAAAATGCACAAATGAAACCAGG - Intronic
1184414491 22:44344353-44344375 CAGGAAGCACAAAGGAAGCAGGG - Intergenic
1184475906 22:44721160-44721182 CAAAACACACAAACAAAGCAAGG + Intronic
1184694113 22:46130373-46130395 CAAAGAGCAGAGATGAAGCAGGG + Intergenic
1184819309 22:46897136-46897158 CAAAATGCACAAACAAAGCTAGG + Intronic
950412057 3:12845081-12845103 CAAGATGCACAAACAAAGCAAGG + Intronic
950658983 3:14454902-14454924 CAAAATGCAGGAAAGAAGCAAGG - Intronic
951443192 3:22746545-22746567 CAAAAAGAACAAATGAAACCAGG - Intergenic
951841984 3:27044226-27044248 CAAAACGCACAAACAAAGCAAGG + Intergenic
952048313 3:29351079-29351101 CAAAATGAACAACTGAGGAAAGG - Intronic
952228382 3:31402912-31402934 TAAAAAGCATTAATGAAGCAGGG + Intergenic
952586466 3:34898750-34898772 CCAAATGGAAAAATTAAGCAGGG - Intergenic
954189278 3:48944958-48944980 TAAAAAGCAGAAATGAAGAAAGG - Intronic
955400004 3:58584949-58584971 CAAAACGCACAAACAAAGCAAGG - Intronic
955524218 3:59804439-59804461 CAAAATGCGCAAACAAAGCAAGG + Intronic
955613263 3:60779971-60779993 CAACTTGCACCCATGAAGCAGGG - Intronic
955788698 3:62566278-62566300 CAAAATGCAAACATGAAACCCGG - Intronic
956933023 3:74067589-74067611 CAAAATGCCCTGATGAAGCCAGG - Intergenic
957297142 3:78346619-78346641 CAAAACGCACAAAGCAAGGATGG - Intergenic
957718804 3:83968647-83968669 CAAAATGAACACACAAAGCAAGG - Intergenic
957719221 3:83972088-83972110 CAAAATGCACAAACAAAGCAAGG - Intergenic
958501934 3:94922278-94922300 AAAAATGAACAAGTGAAGAAAGG - Intergenic
959222280 3:103535687-103535709 CAAAATGCACAAACAAAGCAAGG - Intergenic
959338493 3:105097292-105097314 CAAATTTCTAAAATGAAGCAAGG + Intergenic
959370580 3:105520496-105520518 GAACATGAACAAATGAAGAAAGG - Intronic
959470220 3:106740893-106740915 AAAAATGCAAAAATTAGGCATGG + Intergenic
959516299 3:107270613-107270635 CATAATGCTTTAATGAAGCAAGG - Intergenic
959523042 3:107342364-107342386 CAAAACACACAAACAAAGCAAGG - Intergenic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
959937965 3:112049344-112049366 CAAAATGCACAAAGCAACAAAGG - Intronic
960328679 3:116329583-116329605 CAAAAATTACAAATGAAGTATGG + Intronic
960561242 3:119085867-119085889 CAAAATGCACAAACAAAGCAAGG + Intronic
960985652 3:123278913-123278935 TAAATTGCACAAATGCAACATGG + Intergenic
961429793 3:126873346-126873368 AAGAATGAACAAATAAAGCAAGG - Intronic
961894245 3:130154092-130154114 AAAAATGCAAAAATTAGGCATGG + Intergenic
962246288 3:133796648-133796670 CAAAATGCACAAACAAAGCAAGG - Intronic
962331026 3:134478535-134478557 CAAAGTACACAGATAAAGCATGG - Exonic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
963425735 3:145120344-145120366 CAAAATGTGTAAAAGAAGCAGGG - Intergenic
963914130 3:150841978-150842000 CAAAATGCACAAACAAAGTCAGG - Intergenic
964066765 3:152589215-152589237 CAAAATGAAAACATAAAGCAAGG - Intergenic
964213290 3:154251763-154251785 CAAAAAGTACAAAAGAAGCATGG + Intronic
964300728 3:155282413-155282435 CAAAATGCAAAAACAAAGCAAGG - Intergenic
965534939 3:169813770-169813792 CAAAACGCACAAAGCAAGGAAGG - Intergenic
965849750 3:173009774-173009796 GAAAATGCACACACAAAGCAAGG + Intronic
965860953 3:173149497-173149519 CAACATACACAAATCAATCAAGG + Intergenic
965902180 3:173655882-173655904 CAAAATGCACAGACAAAGCAAGG + Intronic
965903546 3:173673801-173673823 CAAAACGCACAAACAAAGCAAGG + Intronic
965974291 3:174602925-174602947 CAACATACACAAATCAATCAGGG - Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967588131 3:191239114-191239136 CAAAACGCACAAACAAAGCAAGG + Intronic
967732608 3:192919650-192919672 CAAAAAGCAATGATGAAGCAAGG - Intergenic
967940086 3:194758945-194758967 CAAGAAGCAGAAATGAAGCGGGG - Intergenic
967955689 3:194875784-194875806 CACACTGCACACATGTAGCAGGG + Intergenic
968089836 3:195893050-195893072 CAAACAGCACGTATGAAGCAGGG + Intronic
968136144 3:196220851-196220873 CAAAGTTTACAAATGAAGCGAGG - Intronic
968376913 4:51362-51384 CAAAATGCACAAAGTAACAAAGG - Intergenic
968386070 4:139629-139651 CAAAACGCACAAAGCAAGGAAGG - Intronic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
968409540 4:377517-377539 CATAACGCAAAAATGAAGAAAGG - Intronic
968724307 4:2235803-2235825 AATAATGAACAAATTAAGCATGG + Intronic
968937578 4:3620268-3620290 CAAAATGCACAAACCAAGCAAGG + Intergenic
969129441 4:4980800-4980822 CAATGTGCATAAATTAAGCACGG + Intergenic
969748522 4:9092984-9093006 AAAAATGCAAAAATTAGGCATGG - Intergenic
969916522 4:10496982-10497004 CAAAACACACAAACAAAGCAAGG - Intronic
969935011 4:10671654-10671676 GAAAATGCACACATGAGGAAGGG - Intronic
970207751 4:13672611-13672633 CAAACTGGCCAAATGAAACATGG + Intergenic
970811066 4:20094578-20094600 CAAAATGCACAAACAAAGCAAGG - Intergenic
971124013 4:23732673-23732695 CAAAATGCTTACAGGAAGCAAGG + Intergenic
971208914 4:24597380-24597402 GAAAAAGAAAAAATGAAGCAGGG - Intergenic
971213273 4:24640283-24640305 CAAAACGCACAAACAAAGCAAGG + Intergenic
971237302 4:24854410-24854432 CATAATGAATAAATGAAGAAAGG + Intronic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971620067 4:28844719-28844741 CAATATTCACAAATGAGGCCAGG + Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972238159 4:37158217-37158239 CAAAACACACAAACAAAGCAAGG - Intergenic
972262212 4:37420708-37420730 AAAAAGGCACAAAAGGAGCAGGG + Intronic
972812616 4:42607224-42607246 CAGAATACAGAAATGAAGAAAGG + Intronic
972926619 4:44016481-44016503 CAAAACACACAAACAAAGCAAGG + Intergenic
973335471 4:48951522-48951544 CAAAGTGCACAAACAAAACAAGG + Intergenic
973794949 4:54415825-54415847 CAAAATGCACAAACAAAGCAAGG + Intergenic
974189606 4:58488138-58488160 CAAAATGCACAAAACAAGGAAGG + Intergenic
975140660 4:70915311-70915333 CAAAATGCACAGACAAAACAAGG + Intronic
975336830 4:73187699-73187721 CAAAACACACAAACAAAGCAAGG - Intronic
975366210 4:73531474-73531496 CAAAATGCAGAAGTATAGCATGG - Intergenic
975629525 4:76386573-76386595 CAAAACACACAAACAAAGCAAGG - Intronic
976259590 4:83133361-83133383 CAAAATGCACACACAAGGCAAGG + Intronic
976358163 4:84145148-84145170 CAAAATGTACAACTGCAACATGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976558121 4:86472999-86473021 CAAAATGCACAAACAAAGCAAGG - Intronic
978396365 4:108284893-108284915 CAAAATGCACAAGCAAAGCAAGG + Intergenic
978535810 4:109761258-109761280 CCAGATGTTCAAATGAAGCAAGG + Intronic
978588985 4:110303652-110303674 CAAAACGCACAAAGCAAGAAAGG - Intergenic
978950539 4:114553940-114553962 CAAAATGCACAAACAAAGCAAGG + Intergenic
978950543 4:114554026-114554048 CAAAAAGTACAAACAAAGCAAGG + Intergenic
979035701 4:115714056-115714078 AAAAGGACACAAATGAAGCAAGG + Intergenic
979619919 4:122787391-122787413 CAAAACGCACAAGCAAAGCAAGG + Intergenic
979870880 4:125820210-125820232 CAAACTGCAGAACTGAAACATGG - Intergenic
980267838 4:130543004-130543026 GAAAATGCACAAACAAAGCAAGG + Intergenic
980301854 4:131006494-131006516 CAAAACGCACAAAGCAAGGAAGG + Intergenic
980302778 4:131015105-131015127 CAAAACACACAAACAAAGCAAGG + Intergenic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
981925150 4:150131181-150131203 TAAAATGATCAAATGAAGCCAGG - Intronic
981934779 4:150227969-150227991 CAAAACCCCCAAAGGAAGCATGG - Intronic
982043352 4:151417107-151417129 CTAAATGCACAAACAAAGCAAGG + Intronic
982602959 4:157474898-157474920 CAAAATGCAACAAGGCAGCAAGG - Intergenic
983078533 4:163355773-163355795 CAACAGACAGAAATGAAGCAAGG + Intergenic
983090104 4:163493344-163493366 CAAAACACACAAATAAAGCAAGG - Intergenic
983208119 4:164932287-164932309 CAAAGTGCACAAACAAAGCAAGG + Intergenic
984017788 4:174446189-174446211 CAAAATGCACAAACAAAGCAAGG - Intergenic
984431208 4:179651296-179651318 AAACAGGCAGAAATGAAGCAAGG - Intergenic
984636379 4:182114884-182114906 CAAAATCCACAAATCCAGCCAGG + Intergenic
985353522 4:189092913-189092935 CAAAATGCACAAACAAATCAAGG - Intergenic
986211384 5:5676281-5676303 CAAGATCCACAAATGAACCAGGG - Intergenic
986369821 5:7068740-7068762 CAAAATGCATAAACAAAGCAAGG + Intergenic
986484986 5:8227027-8227049 CAAAACGCAGAAACAAAGCAAGG + Intergenic
986531491 5:8740992-8741014 CAAAACACACAAATAAAGCAAGG + Intergenic
986539315 5:8827441-8827463 CAAAATACACCAACAAAGCAAGG + Intergenic
986946808 5:13030888-13030910 GAAAATGCATAAATGATTCATGG + Intergenic
987137655 5:14914713-14914735 CAAAACGCACAAACAAAGCAAGG - Intergenic
987139508 5:14930873-14930895 CAAAATGCACAAACAAAACAAGG - Intergenic
987350900 5:17020891-17020913 CAAAATGCACAAACAAAGCAAGG + Intergenic
987841705 5:23231056-23231078 CAAAATGCACAAACAAAGCAAGG + Intergenic
987842344 5:23237550-23237572 CAAAACGCACAAAGCAAGGAAGG + Intergenic
988348085 5:30066158-30066180 CAAAATACAGAAATGAAGAGAGG - Intergenic
988599185 5:32623754-32623776 CAAGATGCACAAACAAAGCAAGG - Intergenic
988700208 5:33666145-33666167 CAAAACACACAAACAAAGCAAGG - Intronic
989031237 5:37120407-37120429 CAAAAAGCCCAAATTAAGCTGGG + Intronic
989051068 5:37321018-37321040 CAAAAAGCACAAATTCAGGATGG + Intronic
989451307 5:41589263-41589285 GAAAAGGCAAAAAAGAAGCATGG - Intergenic
989567650 5:42916887-42916909 CAAAATGCGCAAGCAAAGCAAGG + Intergenic
989735206 5:44695330-44695352 CAAAATGCACAAACAAAGCAAGG + Intergenic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
992017174 5:72587279-72587301 CAAAATACAAAAAGAAAGCAAGG + Intergenic
992068536 5:73129094-73129116 CAAAATGCACAAACGAAGCAAGG + Intronic
993936475 5:94011021-94011043 CAAAAAGCACAACTTGAGCAAGG + Intronic
994075425 5:95644539-95644561 CTAAAAGAACAAATGAAGGAAGG + Intergenic
994188644 5:96843088-96843110 CAAAACACACAAACAAAGCAAGG + Intronic
994521401 5:100841637-100841659 CAAAACACACAAACAAAGCAAGG - Intronic
994631912 5:102296963-102296985 GAAAACGCACAAACAAAGCAAGG + Intergenic
994777048 5:104048518-104048540 CAAAATACAACAATGAAACAGGG + Intergenic
995020760 5:107364937-107364959 CTTAATTCACAAAGGAAGCATGG - Intergenic
995294435 5:110502748-110502770 TACAATGCCCAAATGAAGGAAGG - Intronic
995298127 5:110543063-110543085 CAAAATGCACAAACAAAACAAGG - Intronic
996120394 5:119665404-119665426 CAAAATGCACAAACAAAGCAAGG + Intergenic
996273367 5:121635970-121635992 CAAAATGCACAAACAAAGCAAGG - Intergenic
996692887 5:126359787-126359809 CAGAATGCACATATGAGACACGG + Intergenic
996853247 5:127976479-127976501 CAAAACGCACCAACAAAGCAAGG + Intergenic
997581191 5:135018503-135018525 CCAAATGCACAAAGGAAAGATGG + Intergenic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
998629109 5:143878659-143878681 CAAAATGCACAAAGTAATAAAGG - Intergenic
998662942 5:144261114-144261136 AAAAATGAACAAATGAAAGAAGG + Intronic
998897079 5:146811157-146811179 AAAAATGCAAAAATTAGGCATGG - Intronic
999284677 5:150387310-150387332 AAAAATGCACAAGAGAAACAAGG - Intronic
999362527 5:150998016-150998038 CAAAATGCACAAACAAAGCAAGG + Intergenic
999526743 5:152414586-152414608 CAAAATGCACAAACAAAGCAAGG - Intronic
999970411 5:156855461-156855483 CAACATACACAAATGACTCAGGG + Intergenic
1000264764 5:159624622-159624644 CAAAATACACAAACAAAGCAAGG - Intergenic
1000556184 5:162729047-162729069 CAAAACGCACAAACAAAGCAAGG + Intergenic
1000698499 5:164419093-164419115 CAAAATGCACAAACAAAGCAAGG + Intergenic
1002015408 5:176317869-176317891 CAAAATGTACAAACAAAGCAAGG + Intronic
1002670038 5:180859363-180859385 CAAAATGTACAAAGGAAAGATGG + Intronic
1002809743 6:616194-616216 CAATAAGCACAAATAAAGAATGG + Intronic
1003162678 6:3649841-3649863 CAAAATGTGCAAACAAAGCAAGG - Intergenic
1003176279 6:3753903-3753925 CAAAACGCACAAACAAAGCAAGG - Intergenic
1003351110 6:5318572-5318594 CAAAAAGCACAAACAAAGCAAGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003698166 6:8433934-8433956 CAAGGAGCAAAAATGAAGCATGG + Intronic
1004965638 6:20847819-20847841 CAAAATGCACAAACAAAGCAAGG + Intronic
1005516950 6:26564147-26564169 CAAAACGCACAAACAGAGCAAGG - Intergenic
1005805785 6:29473343-29473365 GCAATTGAACAAATGAAGCAGGG + Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006431248 6:33998141-33998163 CAACATGCACAAACAAAGCAAGG + Intergenic
1007156834 6:39753131-39753153 CAAAACACACAAATAAAGCAAGG - Intergenic
1007158417 6:39769061-39769083 GAAAATGCCCAAATGACCCATGG - Intergenic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1008959169 6:57248443-57248465 CAAAATGCACAAACAAAGCAAGG + Intergenic
1009035972 6:58117491-58117513 CAAAACACACAAACAAAGCAAGG + Intergenic
1009211789 6:60871092-60871114 CAAAACACACAAACAAAGCAAGG + Intergenic
1009791321 6:68404719-68404741 CAGAAAGCAAAAAGGAAGCAAGG + Intergenic
1009950994 6:70395397-70395419 CAATAGGCACACATGAGGCAGGG - Intergenic
1010072609 6:71761575-71761597 CAAAATGCAAAAATTTAGCCAGG + Intergenic
1010133464 6:72522945-72522967 CAACCAGCACAAATGAGGCAAGG + Intergenic
1010691488 6:78915963-78915985 CAAAATTCACAAACAAAGCAAGG + Intronic
1010795617 6:80113697-80113719 CAAAAGGCACAAAGAAAACAAGG + Intronic
1011844524 6:91546889-91546911 TAAAAGGCAAAAATGAAGAATGG + Intergenic
1012327803 6:97945229-97945251 AAAAAAGCAAAAGTGAAGCAGGG + Intergenic
1012732620 6:102901244-102901266 CAAAACACACAAACAAAGCAAGG - Intergenic
1012849890 6:104433970-104433992 GAAAATGCTAAAATGAAGAATGG + Intergenic
1013104223 6:107012911-107012933 CAAAACACACAAACAAAGCAAGG + Intergenic
1013453941 6:110312814-110312836 CAAAATGCACAAACAAAGGAAGG + Intronic
1013807124 6:114008446-114008468 CAAAATGCACAAACAAAGCAAGG + Intronic
1013807441 6:114011221-114011243 CGAAATGCACAAAGCAAGGAGGG + Intronic
1015074800 6:129142918-129142940 CAAAATGCACAAATATATGAGGG - Intronic
1015630493 6:135227514-135227536 CAAAATGTGCAAATAAAGCAAGG - Intergenic
1015821062 6:137260709-137260731 CAAAACTCACAAATAAAGCAAGG - Intergenic
1015974434 6:138774905-138774927 CACTATGCACAAATAAAGTATGG + Intronic
1016225323 6:141728299-141728321 CAAAATGCACAAACAAAGCAAGG + Intergenic
1016459120 6:144263460-144263482 CAAAACGCACCAACAAAGCAGGG - Intergenic
1016823163 6:148364756-148364778 AAAATAGTACAAATGAAGCATGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017378284 6:153797086-153797108 CAAAATGCACAAACAAAGCAAGG + Intergenic
1017392578 6:153957730-153957752 TAAAACACACAAATAAAGCACGG - Intergenic
1017725912 6:157275649-157275671 CAAAATGCAAAAATTAGCCAGGG + Intergenic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1018327031 6:162681915-162681937 CAAAATGCACAAACAAAGAAAGG - Intronic
1018514872 6:164568598-164568620 CAAAATGCACAAACAAAGCAAGG + Intergenic
1018582549 6:165319585-165319607 CAGAACGCACAAACAAAGCAAGG - Intergenic
1019493117 7:1324265-1324287 GTAAATGAACAAATGAAGGAAGG - Intergenic
1019584861 7:1793778-1793800 CAAGATACACAAAGAAAGCAAGG + Intergenic
1019805122 7:3117932-3117954 CAAAAGGGACAAATGCAGGAGGG - Intergenic
1020324471 7:6963666-6963688 AAAAATGCAAAAATTAGGCATGG + Intergenic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020677190 7:11196715-11196737 CAACTTGCACCCATGAAGCAGGG - Intergenic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1021226873 7:18038008-18038030 CAAAACACACAAACAAAGCAAGG - Intergenic
1021248365 7:18292638-18292660 CAAAATCCACCACTGAAGCATGG - Intronic
1021320543 7:19204944-19204966 CAAAGCGCACAAACAAAGCAAGG + Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1021651382 7:22836905-22836927 CAAAATGCACAAACAAAGCAAGG - Intergenic
1022352164 7:29576595-29576617 CAAAAGGCAAAAAGGAAGCAAGG - Intergenic
1022862789 7:34385317-34385339 CAAAACACACAAATAAAGCAAGG + Intergenic
1023032080 7:36098657-36098679 CAAAATGCAAAAATGAACCCTGG + Intergenic
1023230175 7:38019607-38019629 CAAAACACACAAACAAAGCAAGG - Intronic
1023480341 7:40627187-40627209 CAAAATGCACAAACAAAGCAAGG + Intronic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1023817280 7:43960865-43960887 CAAAATGCACAAAGAAAGCAAGG + Intergenic
1024191873 7:47020394-47020416 AAAAATGCACAAACAAAGCAAGG + Intergenic
1024329227 7:48139824-48139846 CAAAATGCACAAACAAAGCAAGG + Intergenic
1024599157 7:50964359-50964381 CAAAATGCACAAAGCAAGGAGGG - Intergenic
1024630377 7:51242409-51242431 CAAAATGCACAAACAAAGCAAGG - Intronic
1024752369 7:52482737-52482759 CAAAGTGCACAATCAAAGCAAGG + Intergenic
1024829044 7:53426474-53426496 CAAAATACACAAACAAAGCATGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1027181812 7:75946018-75946040 CAAGATGGACAAATAAATCAGGG - Intronic
1027580145 7:79982937-79982959 AAAAAAGCAGAAATGAAGGACGG + Intergenic
1027643427 7:80766619-80766641 CAAAACACACAAACAAAGCAAGG - Intronic
1027696062 7:81411932-81411954 CAAAATGCACAAACAAAGCAAGG + Intergenic
1028303931 7:89238051-89238073 CAAAATGCACGAATGAATGCAGG + Intronic
1030144924 7:106343216-106343238 CAAAATACACAAACAAAGCAAGG - Intergenic
1030366459 7:108652796-108652818 CAAAATGCACAAACAAAGCAAGG + Intergenic
1030492375 7:110254148-110254170 GAAAAGGCAGAAATGAGGCATGG - Intergenic
1030595591 7:111535299-111535321 CAAAAAGGAGAAATGAAGGAAGG + Intronic
1030714558 7:112792157-112792179 CAAAACGCACAAACAAAGCAAGG - Intergenic
1030758725 7:113323591-113323613 CAAAAAGCAAAGAAGAAGCATGG - Intergenic
1030973440 7:116090450-116090472 CAAAATGCACAAACAAAGCAAGG - Intronic
1031019924 7:116616188-116616210 CAGAATGCAAAATTGAACCAAGG + Intergenic
1031094071 7:117398207-117398229 CAAAATGCACAAAGTAAGAAAGG - Intronic
1031444397 7:121832754-121832776 AAAAATTCACAAATGCATCATGG - Intergenic
1031564168 7:123274226-123274248 CAAAATACACAAAGTAAACAGGG - Intergenic
1032252648 7:130271292-130271314 CAAAACGCACAAACAAAACAAGG + Intronic
1032311817 7:130794553-130794575 CAAAACGCACAAACAAAGCAAGG + Intergenic
1032405949 7:131655566-131655588 CCAAATGTACAAATGAATGAAGG - Intergenic
1033665127 7:143433539-143433561 CTAAATGCTCGAATGGAGCAAGG + Intergenic
1033850535 7:145489035-145489057 CAAACTGCATAAACAAAGCAGGG + Intergenic
1033874513 7:145798223-145798245 CAAAACGCACAAACTAAGCAAGG - Intergenic
1034684013 7:152953988-152954010 CAAAACGCACAAACAAAGCAAGG + Intergenic
1034736328 7:153432461-153432483 CAAAACGCACCAACAAAGCAAGG + Intergenic
1035011590 7:155722242-155722264 CAAAGTGCCCAAATGTAACAGGG - Intronic
1035013667 7:155743944-155743966 CAAACTGCAAAAATGAAGGTGGG - Intronic
1035026163 7:155827718-155827740 CAAAAAGCAAAAAAGAAACATGG - Intergenic
1035063303 7:156085968-156085990 CAAAATGTACAAAAAAGGCATGG + Intergenic
1035142476 7:156776679-156776701 CAAAATTCACTAGTGAACCATGG - Intronic
1035511523 8:189802-189824 CAAAATGCATAAACGAAAGAAGG + Intergenic
1035785760 8:2259331-2259353 TAAAATGTACAAATCAAGCATGG - Intergenic
1035807047 8:2462385-2462407 TAAAATGTACAAATCAAGCATGG + Intergenic
1036371593 8:8167285-8167307 AAAAATGCAAAAATTAGGCATGG - Intergenic
1036879310 8:12498359-12498381 AAAAATGCAAAAATTAGGCATGG + Intergenic
1037137133 8:15476623-15476645 CCAAATGCACAAACAAAGCTGGG + Intronic
1037532555 8:19791741-19791763 CAAAACACACAAACAAAGCAAGG - Intergenic
1038378846 8:27072915-27072937 CAAAATCCACAAGGGAAACAGGG - Intergenic
1038404979 8:27314746-27314768 AAAAACGCACAAACTAAGCAGGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1039300975 8:36208478-36208500 CTAAAGGCACCAAGGAAGCAGGG - Intergenic
1039589466 8:38734575-38734597 CAAAATGCCCCAAGGTAGCAGGG + Intronic
1040634994 8:49262741-49262763 CAAAACACACGAATAAAGCAAGG - Intergenic
1041828105 8:62121409-62121431 CAAAATGCACAAAGCAAGGAAGG + Intergenic
1043162426 8:76862661-76862683 CAAACTGCTCAAGTGAAGGACGG + Intronic
1043458174 8:80432601-80432623 CAAAATGCACAAACAAACCGAGG + Intergenic
1043545586 8:81312162-81312184 CAAAGTGCAAAAATGAAGCAGGG + Intergenic
1043570107 8:81593461-81593483 CAAAAAGAACAAATGAAAAAGGG + Intergenic
1043591988 8:81843318-81843340 CAAAACGCACAAAGAAAGCAAGG + Intergenic
1043820613 8:84859006-84859028 CAAAACGCACAAACAAAGGAAGG + Intronic
1044310615 8:90687863-90687885 CAAAATGCACAAACAGAGCAAGG - Intronic
1045288468 8:100811875-100811897 CAAAACACACAAACAAAGCAAGG + Intergenic
1045549667 8:103160160-103160182 CAAAATGCACAAACAAAGCAAGG + Intronic
1046486641 8:114896035-114896057 CAAAATGCAATAACAAAGCAAGG - Intergenic
1046487284 8:114902992-114903014 CAAAACACACAAACAAAGCAAGG - Intergenic
1046586324 8:116152957-116152979 AAAACTGCATAAATGAAGAAGGG - Intergenic
1046645156 8:116777797-116777819 CAGAATGGACACAAGAAGCAAGG - Intronic
1047073938 8:121378667-121378689 CAAAATGCACAAACAAAGCAAGG - Intergenic
1047539472 8:125750501-125750523 CAAAACACACAAACAAAGCATGG - Intergenic
1047682893 8:127273022-127273044 CAAAATGCATAAACAAAGCAAGG - Intergenic
1047889151 8:129288136-129288158 CAAAATGCATAAATAAAGCAAGG - Intergenic
1047964467 8:130035795-130035817 AAAAATGAACAAATGAACCGAGG + Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1050139406 9:2501978-2502000 CAAAATGCACAAAACAAGGAAGG + Intergenic
1050723906 9:8624194-8624216 CAATAAGCACAAATGTAACAGGG + Intronic
1050899837 9:10933053-10933075 CAAAACACACAAACAAAGCAAGG - Intergenic
1050920178 9:11190516-11190538 CAAAAAGAACAAATTAAACATGG - Intergenic
1050964902 9:11787607-11787629 CAAAATGCAGAAATGCTGAAAGG + Intergenic
1051282792 9:15459756-15459778 CAAACATCACAAAAGAAGCATGG - Exonic
1051936519 9:22447956-22447978 GATAATGAAAAAATGAAGCATGG + Intronic
1052422127 9:28256187-28256209 AAAAATAGAAAAATGAAGCAAGG - Intronic
1052598805 9:30597563-30597585 CAAAATGTACAATTGAGGTAGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053358989 9:37469565-37469587 CAAAACACACAAACAAAGCAAGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054453578 9:65417424-65417446 CAAAATGCACAAACCAAGCAAGG - Intergenic
1054771675 9:69089593-69089615 CACAAAGCACAAAGAAAGCAAGG - Intronic
1054979382 9:71186578-71186600 AAAAATACACAAATAAATCATGG + Intronic
1055486133 9:76758644-76758666 CACAATGCCCAGATGAATCACGG + Intronic
1055766487 9:79669038-79669060 ATACATGCACAAATGAAGCCTGG - Intronic
1056429773 9:86515588-86515610 AAAAATACACAAAAGAAGCTTGG - Intergenic
1056447244 9:86677868-86677890 CAAAATGCACAAGCAAAGCAAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056878768 9:90367512-90367534 CAAAATGAACAAGTGAGGTATGG - Intergenic
1056915615 9:90743499-90743521 CAAAATGCAGACATGATGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058971573 9:110088059-110088081 CAAAATGCACAAACAAAGGAAGG + Intronic
1059307476 9:113366161-113366183 CAAAAGGTACAAATGTAGAAAGG - Intronic
1059689705 9:116673240-116673262 CAAAACCCACAAACAAAGCAAGG - Intronic
1059784949 9:117571525-117571547 CAAAATGCACAAACAAAGCAAGG - Intergenic
1060176741 9:121502852-121502874 AAAAATGCAGAAACAAAGCAAGG - Intergenic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1062484157 9:136766058-136766080 CAAAACACACAAACAAAGCAAGG - Intronic
1203572321 Un_KI270744v1:142884-142906 CAAAATGCACAAAGTAACAAAGG + Intergenic
1186166065 X:6827280-6827302 CAAAATGCAAAAACAAAGCAAGG + Intergenic
1186182174 X:6984002-6984024 CAAAATGCACACACAAAGCAAGG - Intergenic
1186242227 X:7581672-7581694 CAAAATGCATTAAAGAAGCCAGG + Intergenic
1186300229 X:8192737-8192759 CAAAATGCATAAATAAAGTAAGG + Intergenic
1186764677 X:12758796-12758818 CAAAAGGAACAAATGAAAAAGGG + Intergenic
1187162159 X:16774701-16774723 CAAAACGCACAAAGCAAGGAAGG + Intergenic
1187240353 X:17507470-17507492 CAAAGTGAAAAAATGAAGAATGG + Intronic
1187379950 X:18792735-18792757 CAAAACGCACAAACAAAGCAAGG + Intronic
1187413023 X:19067282-19067304 CAAAACGCACTAACAAAGCAAGG - Intronic
1187479381 X:19641084-19641106 CAAAACGCACAAACAAAGCAAGG - Intronic
1188518243 X:31010549-31010571 CAAAACACACAAACAAAGCAAGG + Intergenic
1188680824 X:33002278-33002300 CAAAATGCACAAACAAAGCAAGG + Intronic
1188863171 X:35282688-35282710 CAAAATGCACCAAGAATGCAGGG + Intergenic
1189069485 X:37848518-37848540 CAAAACGCACAAACAAAGCAAGG + Intronic
1189290845 X:39884915-39884937 CAAAACACACAAACAAAGCAAGG + Intergenic
1189414810 X:40804383-40804405 CAACATGCACCCATGAAGCAGGG + Intergenic
1189415818 X:40812484-40812506 CAAAATACACAAACAAAGCAAGG + Intergenic
1189761759 X:44329002-44329024 CAAAATGCACAAACAAAGCAAGG - Intronic
1189815163 X:44817453-44817475 CAAAACGCACAAACAAAGCAAGG + Intergenic
1189867293 X:45344242-45344264 CAAAATGCACAAACAAAGCAAGG - Intergenic
1190408447 X:50111010-50111032 AAAAACGCACAAACAAAGCAAGG + Intergenic
1190408912 X:50115182-50115204 CAAAATGCACAAACAAAGCAAGG - Intergenic
1190470259 X:50771408-50771430 CAAACTGCCAAAATGAAGAAAGG - Intronic
1191837472 X:65479767-65479789 CAAAACTCACAAACAAAGCAAGG + Intronic
1192418932 X:71011114-71011136 CAAAATGCACAAAGTTAGGAAGG - Intergenic
1192479381 X:71471633-71471655 CAAAAGGCACAAACAAAGCAAGG + Intronic
1192570705 X:72201849-72201871 CGAAACGCACAAACAAAGCAAGG + Intronic
1192882989 X:75307381-75307403 CAAATTGGAAAAATAAAGCAAGG - Intergenic
1192991002 X:76456051-76456073 TAAAATGCAAAAATGAAGTGAGG - Intergenic
1193116234 X:77778245-77778267 CAAAATGCACAATAGTAGCTGGG + Intronic
1193135139 X:77962466-77962488 CAAAACGCACAAACAAAGCAAGG - Intronic
1193139716 X:78014889-78014911 CAAAATGGATAGATGAAGTATGG - Intronic
1193507774 X:82364156-82364178 CAAAATGCACAAACAAAGCAAGG + Intergenic
1193945116 X:87724788-87724810 CAACTTGCACCCATGAAGCAGGG + Intergenic
1193988047 X:88270585-88270607 CAAAACACACAAACAAAGCAAGG - Intergenic
1194057976 X:89161810-89161832 CAAAAAGCAGAAAAAAAGCAGGG - Intergenic
1194379879 X:93178661-93178683 CAAAATGGCCAATTGAACCATGG - Intergenic
1194690375 X:96977086-96977108 CAAAATGCACAAATTACTAAGGG - Intronic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1195117048 X:101709607-101709629 CAACATGCACAAATCAGGCTGGG + Intergenic
1195143384 X:101987020-101987042 CAAAACGCACAAACAAAGCAAGG - Intergenic
1195256701 X:103097703-103097725 CAAAACGCACAAACAAAGCAAGG - Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196401251 X:115318756-115318778 CAAAATGCACAAACAAAGCAAGG + Intergenic
1196420237 X:115513696-115513718 CAAAACGCACAAAGCAAGGAAGG - Intergenic
1196464325 X:115957800-115957822 CAAAATGTACAAACAAAGCAAGG - Intergenic
1196739531 X:119012417-119012439 CAAAATGGACTAAGGAAGCCAGG - Intronic
1196774911 X:119329492-119329514 CAAAATGCATAAACAAAGCAAGG + Intergenic
1196779698 X:119372798-119372820 CAAAACACACAAATAAAGCAAGG + Intergenic
1196967773 X:121077105-121077127 CAAAATGCACAAACAAAACAAGG + Intergenic
1196968488 X:121084016-121084038 CAAAACACAAAAACGAAGCAAGG + Intergenic
1196973312 X:121132773-121132795 CAAAACGCATAAACAAAGCAAGG + Intergenic
1196974393 X:121142380-121142402 CAAAATGTACAAGCAAAGCAAGG + Intergenic
1197062275 X:122195669-122195691 CAGCTTGCACCAATGAAGCAAGG - Intergenic
1197243627 X:124146147-124146169 TAAAATGCACAAACAGAGCAAGG + Intronic
1197524843 X:127548238-127548260 CCAAATTCACAACTGAATCAAGG - Intergenic
1198100971 X:133421443-133421465 CAAAACACACAAACAAAGCAAGG - Intergenic
1198221077 X:134603096-134603118 CAAAATGGATAAATCAAGAATGG + Intronic
1198273777 X:135081530-135081552 CAAAGTGCATAAGTAAAGCAGGG + Intergenic
1198273933 X:135083381-135083403 CAAAAGGCAAAAAAGAATCAAGG - Intergenic
1198383682 X:136107416-136107438 CAAAACGCACAAACAAAGTAAGG - Intergenic
1198747004 X:139901185-139901207 AAGAATGCCCAAATGAAGCATGG + Intronic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199703929 X:150407401-150407423 CAACATGCATAATTGAAGAAAGG + Intronic
1200734087 Y:6775199-6775221 CAAAATGCACAAACAAAGCAAGG + Intergenic
1200735216 Y:6786815-6786837 CAAGATGCACAAAAAAAGCAAGG + Intergenic
1200762638 Y:7054178-7054200 CAAGATGCACAAACAAAGCAAGG + Intronic
1201330867 Y:12819395-12819417 AAAAATGCAAAAATTAAGCATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201507333 Y:14717087-14717109 CAAAATACAAAAATTAACCAGGG + Intronic
1201653042 Y:16312878-16312900 CAAAATGCATAAAAGTAACATGG + Intergenic
1201854401 Y:18525387-18525409 CAAAAGGCACAAGACAAGCATGG + Intergenic
1201878920 Y:18794998-18795020 CAAAAGGCACAAGACAAGCATGG - Intronic
1202044513 Y:20725110-20725132 TAAAATGCACAAACGAAGCAAGG + Intergenic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202368365 Y:24181851-24181873 CCATATACAAAAATGAAGCAGGG - Intergenic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic
1202502420 Y:25488266-25488288 CCATATACAAAAATGAAGCAGGG + Intergenic