ID: 1114921773

View in Genome Browser
Species Human (GRCh38)
Location 14:27341802-27341824
Sequence TTCAAGGTGAGATTTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36928
Summary {0: 1231, 1: 9508, 2: 11048, 3: 8658, 4: 6483}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114921773_1114921786 16 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921786 14:27341841-27341863 GTGTTGGGGGAGGAACCTGGTGG No data
1114921773_1114921785 13 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921785 14:27341838-27341860 CATGTGTTGGGGGAGGAACCTGG No data
1114921773_1114921780 3 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921780 14:27341828-27341850 TAATAATCCCCATGTGTTGGGGG No data
1114921773_1114921777 0 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921777 14:27341825-27341847 TTGTAATAATCCCCATGTGTTGG 0: 4
1: 2
2: 13
3: 43
4: 194
1114921773_1114921778 1 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG No data
1114921773_1114921781 6 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921781 14:27341831-27341853 TAATCCCCATGTGTTGGGGGAGG 0: 56
1: 500
2: 2199
3: 5142
4: 7497
1114921773_1114921787 17 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921787 14:27341842-27341864 TGTTGGGGGAGGAACCTGGTGGG No data
1114921773_1114921788 20 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921788 14:27341845-27341867 TGGGGGAGGAACCTGGTGGGAGG 0: 17
1: 259
2: 1611
3: 3748
4: 7981
1114921773_1114921779 2 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921779 14:27341827-27341849 GTAATAATCCCCATGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114921773 Original CRISPR TTCAAGGTGAGATTTGGGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr