ID: 1114921775

View in Genome Browser
Species Human (GRCh38)
Location 14:27341808-27341830
Sequence TTACAATTCAAGGTGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37786
Summary {0: 1022, 1: 3742, 2: 10594, 3: 11678, 4: 10750}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114921775_1114921791 29 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921791 14:27341860-27341882 GTGGGAGGTAATTGAATCATGGG 0: 2873
1: 6123
2: 9027
3: 10130
4: 8836
1114921775_1114921792 30 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921792 14:27341861-27341883 TGGGAGGTAATTGAATCATGGGG 0: 2899
1: 6143
2: 9065
3: 10407
4: 10204
1114921775_1114921781 0 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921781 14:27341831-27341853 TAATCCCCATGTGTTGGGGGAGG 0: 56
1: 500
2: 2199
3: 5142
4: 7497
1114921775_1114921788 14 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921788 14:27341845-27341867 TGGGGGAGGAACCTGGTGGGAGG 0: 17
1: 259
2: 1611
3: 3748
4: 7981
1114921775_1114921786 10 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921786 14:27341841-27341863 GTGTTGGGGGAGGAACCTGGTGG No data
1114921775_1114921778 -5 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG No data
1114921775_1114921779 -4 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921779 14:27341827-27341849 GTAATAATCCCCATGTGTTGGGG No data
1114921775_1114921780 -3 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921780 14:27341828-27341850 TAATAATCCCCATGTGTTGGGGG No data
1114921775_1114921790 28 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921790 14:27341859-27341881 GGTGGGAGGTAATTGAATCATGG 0: 1659
1: 4879
2: 8898
3: 10570
4: 9952
1114921775_1114921777 -6 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921777 14:27341825-27341847 TTGTAATAATCCCCATGTGTTGG 0: 4
1: 2
2: 13
3: 43
4: 194
1114921775_1114921787 11 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921787 14:27341842-27341864 TGTTGGGGGAGGAACCTGGTGGG No data
1114921775_1114921785 7 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921785 14:27341838-27341860 CATGTGTTGGGGGAGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114921775 Original CRISPR TTACAATTCAAGGTGAGATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr