ID: 1114921778

View in Genome Browser
Species Human (GRCh38)
Location 14:27341826-27341848
Sequence TGTAATAATCCCCATGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114921773_1114921778 1 Left 1114921773 14:27341802-27341824 CCTCACCCAAATCTCACCTTGAA 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
Right 1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG No data
1114921774_1114921778 -4 Left 1114921774 14:27341807-27341829 CCCAAATCTCACCTTGAATTGTA 0: 1257
1: 8964
2: 10159
3: 8288
4: 7147
Right 1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG No data
1114921775_1114921778 -5 Left 1114921775 14:27341808-27341830 CCAAATCTCACCTTGAATTGTAA 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
Right 1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114921778 Original CRISPR TGTAATAATCCCCATGTGTT GGG Intergenic
No off target data available for this crispr