ID: 1114925490

View in Genome Browser
Species Human (GRCh38)
Location 14:27392232-27392254
Sequence TTCCCCTAACTGCCTTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114925490_1114925494 14 Left 1114925490 14:27392232-27392254 CCTCTGGAAGGCAGTTAGGGGAA No data
Right 1114925494 14:27392269-27392291 ACTACTTGTAGGAGTGTGAAGGG No data
1114925490_1114925495 25 Left 1114925490 14:27392232-27392254 CCTCTGGAAGGCAGTTAGGGGAA No data
Right 1114925495 14:27392280-27392302 GAGTGTGAAGGGACAAAGCCTGG No data
1114925490_1114925493 13 Left 1114925490 14:27392232-27392254 CCTCTGGAAGGCAGTTAGGGGAA No data
Right 1114925493 14:27392268-27392290 GACTACTTGTAGGAGTGTGAAGG No data
1114925490_1114925492 3 Left 1114925490 14:27392232-27392254 CCTCTGGAAGGCAGTTAGGGGAA No data
Right 1114925492 14:27392258-27392280 AGGACATAGAGACTACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114925490 Original CRISPR TTCCCCTAACTGCCTTCCAG AGG (reversed) Intergenic
No off target data available for this crispr