ID: 1114928085

View in Genome Browser
Species Human (GRCh38)
Location 14:27430758-27430780
Sequence CCTCGTTAGAAACTATTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114928083_1114928085 -4 Left 1114928083 14:27430739-27430761 CCTTTAAAAATGTTTTTGGCCTC No data
Right 1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG No data
1114928081_1114928085 4 Left 1114928081 14:27430731-27430753 CCAGTAAACCTTTAAAAATGTTT No data
Right 1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114928085 Original CRISPR CCTCGTTAGAAACTATTGCC AGG Intergenic
No off target data available for this crispr