ID: 1114933810

View in Genome Browser
Species Human (GRCh38)
Location 14:27507705-27507727
Sequence CAGGCTACTCAGGAAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114933810_1114933820 30 Left 1114933810 14:27507705-27507727 CCCTCAACTTCCTGAGTAGCCTG No data
Right 1114933820 14:27507758-27507780 AATTTTAATAGTTTTAGTAGTGG No data
1114933810_1114933816 5 Left 1114933810 14:27507705-27507727 CCCTCAACTTCCTGAGTAGCCTG No data
Right 1114933816 14:27507733-27507755 CAGGCATATGCCACCATGCCTGG 0: 398
1: 9132
2: 37294
3: 94381
4: 170322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114933810 Original CRISPR CAGGCTACTCAGGAAGTTGA GGG (reversed) Intergenic
No off target data available for this crispr