ID: 1114945120

View in Genome Browser
Species Human (GRCh38)
Location 14:27671758-27671780
Sequence CAGTAGGAATAGGAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114945120_1114945132 28 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945132 14:27671809-27671831 GGATGTGGTGGTGAGGGTGTGGG No data
1114945120_1114945131 27 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945131 14:27671808-27671830 AGGATGTGGTGGTGAGGGTGTGG No data
1114945120_1114945127 16 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945127 14:27671797-27671819 TTCTTGCCTCAAGGATGTGGTGG No data
1114945120_1114945130 22 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945130 14:27671803-27671825 CCTCAAGGATGTGGTGGTGAGGG No data
1114945120_1114945125 7 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945125 14:27671788-27671810 CTCAGTAGATTCTTGCCTCAAGG No data
1114945120_1114945126 13 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945126 14:27671794-27671816 AGATTCTTGCCTCAAGGATGTGG No data
1114945120_1114945128 21 Left 1114945120 14:27671758-27671780 CCTATTTCCTCCTATTCCTACTG No data
Right 1114945128 14:27671802-27671824 GCCTCAAGGATGTGGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114945120 Original CRISPR CAGTAGGAATAGGAGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr