ID: 1114952514

View in Genome Browser
Species Human (GRCh38)
Location 14:27773645-27773667
Sequence TTGGAGACTCAGAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114952514_1114952523 16 Left 1114952514 14:27773645-27773667 CCCTCCCCGCTCTGAGTCTCCAA No data
Right 1114952523 14:27773684-27773706 TGTATGACTTTGCGTAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114952514 Original CRISPR TTGGAGACTCAGAGCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr