ID: 1114956666

View in Genome Browser
Species Human (GRCh38)
Location 14:27829077-27829099
Sequence TCATTTCCACACAAAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114956666_1114956669 19 Left 1114956666 14:27829077-27829099 CCATTTTCTTTGTGTGGAAATGA No data
Right 1114956669 14:27829119-27829141 TAATGTGTTTTCAATGGTGAGGG No data
1114956666_1114956667 13 Left 1114956666 14:27829077-27829099 CCATTTTCTTTGTGTGGAAATGA No data
Right 1114956667 14:27829113-27829135 GTCAGTTAATGTGTTTTCAATGG No data
1114956666_1114956670 20 Left 1114956666 14:27829077-27829099 CCATTTTCTTTGTGTGGAAATGA No data
Right 1114956670 14:27829120-27829142 AATGTGTTTTCAATGGTGAGGGG No data
1114956666_1114956668 18 Left 1114956666 14:27829077-27829099 CCATTTTCTTTGTGTGGAAATGA No data
Right 1114956668 14:27829118-27829140 TTAATGTGTTTTCAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114956666 Original CRISPR TCATTTCCACACAAAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr