ID: 1114956670

View in Genome Browser
Species Human (GRCh38)
Location 14:27829120-27829142
Sequence AATGTGTTTTCAATGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114956666_1114956670 20 Left 1114956666 14:27829077-27829099 CCATTTTCTTTGTGTGGAAATGA No data
Right 1114956670 14:27829120-27829142 AATGTGTTTTCAATGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114956670 Original CRISPR AATGTGTTTTCAATGGTGAG GGG Intergenic
No off target data available for this crispr