ID: 1114957050

View in Genome Browser
Species Human (GRCh38)
Location 14:27835554-27835576
Sequence GCAATTTGTTATGACAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114957050_1114957051 23 Left 1114957050 14:27835554-27835576 CCAGGGTTGTCATAACAAATTGC No data
Right 1114957051 14:27835600-27835622 ACAGAAATTGATTCTCTCACAGG No data
1114957050_1114957052 28 Left 1114957050 14:27835554-27835576 CCAGGGTTGTCATAACAAATTGC No data
Right 1114957052 14:27835605-27835627 AATTGATTCTCTCACAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114957050 Original CRISPR GCAATTTGTTATGACAACCC TGG (reversed) Intergenic
No off target data available for this crispr