ID: 1114958249

View in Genome Browser
Species Human (GRCh38)
Location 14:27849695-27849717
Sequence GGCACTGATGTGATGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114958249_1114958257 5 Left 1114958249 14:27849695-27849717 CCTGCTGGCATCACATCAGTGCC No data
Right 1114958257 14:27849723-27849745 GGGATGGAGCTCACAGAGGAAGG No data
1114958249_1114958256 1 Left 1114958249 14:27849695-27849717 CCTGCTGGCATCACATCAGTGCC No data
Right 1114958256 14:27849719-27849741 CTCTGGGATGGAGCTCACAGAGG No data
1114958249_1114958258 11 Left 1114958249 14:27849695-27849717 CCTGCTGGCATCACATCAGTGCC No data
Right 1114958258 14:27849729-27849751 GAGCTCACAGAGGAAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114958249 Original CRISPR GGCACTGATGTGATGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr