ID: 1114964382

View in Genome Browser
Species Human (GRCh38)
Location 14:27939422-27939444
Sequence GCAGCCAGGAAGTTTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114964376_1114964382 30 Left 1114964376 14:27939369-27939391 CCTGGCAGGCAGAGGGGCGTCTG No data
Right 1114964382 14:27939422-27939444 GCAGCCAGGAAGTTTGAACTGGG No data
1114964379_1114964382 7 Left 1114964379 14:27939392-27939414 CCATTGCTGAGGCTTGAGTAGGT 0: 1335
1: 1630
2: 1504
3: 1312
4: 2555
Right 1114964382 14:27939422-27939444 GCAGCCAGGAAGTTTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114964382 Original CRISPR GCAGCCAGGAAGTTTGAACT GGG Intergenic
No off target data available for this crispr