ID: 1114976566

View in Genome Browser
Species Human (GRCh38)
Location 14:28107890-28107912
Sequence ACATAGAAATTACATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114976566_1114976572 14 Left 1114976566 14:28107890-28107912 CCACCCCAATGTAATTTCTATGT No data
Right 1114976572 14:28107927-28107949 GAACAACTATTAAAATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114976566 Original CRISPR ACATAGAAATTACATTGGGG TGG (reversed) Intergenic
No off target data available for this crispr