ID: 1114978143

View in Genome Browser
Species Human (GRCh38)
Location 14:28127463-28127485
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114978143_1114978145 11 Left 1114978143 14:28127463-28127485 CCAATCCTGTTGATATGTTATTT No data
Right 1114978145 14:28127497-28127519 AGCAGCTAAGCAGTGAAGTATGG No data
1114978143_1114978148 24 Left 1114978143 14:28127463-28127485 CCAATCCTGTTGATATGTTATTT No data
Right 1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG No data
1114978143_1114978147 13 Left 1114978143 14:28127463-28127485 CCAATCCTGTTGATATGTTATTT No data
Right 1114978147 14:28127499-28127521 CAGCTAAGCAGTGAAGTATGGGG No data
1114978143_1114978146 12 Left 1114978143 14:28127463-28127485 CCAATCCTGTTGATATGTTATTT No data
Right 1114978146 14:28127498-28127520 GCAGCTAAGCAGTGAAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114978143 Original CRISPR AAATAACATATCAACAGGAT TGG (reversed) Intergenic