ID: 1114978143 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:28127463-28127485 |
Sequence | AAATAACATATCAACAGGAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114978143_1114978145 | 11 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
Right | 1114978145 | 14:28127497-28127519 | AGCAGCTAAGCAGTGAAGTATGG | No data | ||||
1114978143_1114978148 | 24 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
Right | 1114978148 | 14:28127510-28127532 | TGAAGTATGGGGCCCTACAATGG | No data | ||||
1114978143_1114978147 | 13 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
Right | 1114978147 | 14:28127499-28127521 | CAGCTAAGCAGTGAAGTATGGGG | No data | ||||
1114978143_1114978146 | 12 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
Right | 1114978146 | 14:28127498-28127520 | GCAGCTAAGCAGTGAAGTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114978143 | Original CRISPR | AAATAACATATCAACAGGAT TGG (reversed) | Intergenic | ||