ID: 1114978144

View in Genome Browser
Species Human (GRCh38)
Location 14:28127468-28127490
Sequence CTTCAAAATAACATATCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114978144_1114978146 7 Left 1114978144 14:28127468-28127490 CCTGTTGATATGTTATTTTGAAG No data
Right 1114978146 14:28127498-28127520 GCAGCTAAGCAGTGAAGTATGGG No data
1114978144_1114978145 6 Left 1114978144 14:28127468-28127490 CCTGTTGATATGTTATTTTGAAG No data
Right 1114978145 14:28127497-28127519 AGCAGCTAAGCAGTGAAGTATGG No data
1114978144_1114978148 19 Left 1114978144 14:28127468-28127490 CCTGTTGATATGTTATTTTGAAG No data
Right 1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG No data
1114978144_1114978147 8 Left 1114978144 14:28127468-28127490 CCTGTTGATATGTTATTTTGAAG No data
Right 1114978147 14:28127499-28127521 CAGCTAAGCAGTGAAGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114978144 Original CRISPR CTTCAAAATAACATATCAAC AGG (reversed) Intergenic