ID: 1114978148

View in Genome Browser
Species Human (GRCh38)
Location 14:28127510-28127532
Sequence TGAAGTATGGGGCCCTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114978143_1114978148 24 Left 1114978143 14:28127463-28127485 CCAATCCTGTTGATATGTTATTT No data
Right 1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG No data
1114978144_1114978148 19 Left 1114978144 14:28127468-28127490 CCTGTTGATATGTTATTTTGAAG No data
Right 1114978148 14:28127510-28127532 TGAAGTATGGGGCCCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114978148 Original CRISPR TGAAGTATGGGGCCCTACAA TGG Intergenic
No off target data available for this crispr