ID: 1114978148 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:28127510-28127532 |
Sequence | TGAAGTATGGGGCCCTACAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114978143_1114978148 | 24 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
Right | 1114978148 | 14:28127510-28127532 | TGAAGTATGGGGCCCTACAATGG | No data | ||||
1114978144_1114978148 | 19 | Left | 1114978144 | 14:28127468-28127490 | CCTGTTGATATGTTATTTTGAAG | No data | ||
Right | 1114978148 | 14:28127510-28127532 | TGAAGTATGGGGCCCTACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114978148 | Original CRISPR | TGAAGTATGGGGCCCTACAA TGG | Intergenic | ||