ID: 1114978148 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:28127510-28127532 |
| Sequence | TGAAGTATGGGGCCCTACAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114978143_1114978148 | 24 | Left | 1114978143 | 14:28127463-28127485 | CCAATCCTGTTGATATGTTATTT | No data | ||
| Right | 1114978148 | 14:28127510-28127532 | TGAAGTATGGGGCCCTACAATGG | No data | ||||
| 1114978144_1114978148 | 19 | Left | 1114978144 | 14:28127468-28127490 | CCTGTTGATATGTTATTTTGAAG | No data | ||
| Right | 1114978148 | 14:28127510-28127532 | TGAAGTATGGGGCCCTACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114978148 | Original CRISPR | TGAAGTATGGGGCCCTACAA TGG | Intergenic | ||