ID: 1114995095

View in Genome Browser
Species Human (GRCh38)
Location 14:28339464-28339486
Sequence CTACCTTACTAAGGTAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114995095_1114995097 0 Left 1114995095 14:28339464-28339486 CCAATTTTACCTTAGTAAGGTAG No data
Right 1114995097 14:28339487-28339509 CTTTAGACTTTCTGTGATTAAGG No data
1114995095_1114995098 5 Left 1114995095 14:28339464-28339486 CCAATTTTACCTTAGTAAGGTAG No data
Right 1114995098 14:28339492-28339514 GACTTTCTGTGATTAAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114995095 Original CRISPR CTACCTTACTAAGGTAAAAT TGG (reversed) Intergenic
No off target data available for this crispr