ID: 1114995643

View in Genome Browser
Species Human (GRCh38)
Location 14:28348709-28348731
Sequence CAGCTGTTAAAGAGTACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114995643_1114995645 4 Left 1114995643 14:28348709-28348731 CCCTTTGTACTCTTTAACAGCTG No data
Right 1114995645 14:28348736-28348758 AGTCTATTTTGTCTACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114995643 Original CRISPR CAGCTGTTAAAGAGTACAAA GGG (reversed) Intergenic
No off target data available for this crispr