ID: 1114996900

View in Genome Browser
Species Human (GRCh38)
Location 14:28365268-28365290
Sequence CTACAGTACCAGGTTTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114996900_1114996904 0 Left 1114996900 14:28365268-28365290 CCCATAGAAACCTGGTACTGTAG No data
Right 1114996904 14:28365291-28365313 CAGGCACACACACAAGTGACTGG No data
1114996900_1114996906 20 Left 1114996900 14:28365268-28365290 CCCATAGAAACCTGGTACTGTAG No data
Right 1114996906 14:28365311-28365333 TGGATGTCAAGAGGAGCAGAAGG No data
1114996900_1114996905 11 Left 1114996900 14:28365268-28365290 CCCATAGAAACCTGGTACTGTAG No data
Right 1114996905 14:28365302-28365324 ACAAGTGACTGGATGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114996900 Original CRISPR CTACAGTACCAGGTTTCTAT GGG (reversed) Intergenic
No off target data available for this crispr