ID: 1115006366

View in Genome Browser
Species Human (GRCh38)
Location 14:28490049-28490071
Sequence ATGTCCATCCAAAAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 2, 2: 2, 3: 29, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115006362_1115006366 19 Left 1115006362 14:28490007-28490029 CCCGTTTCCAAAGTGCTGAGACA 0: 1
1: 1
2: 11
3: 26
4: 306
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228
1115006359_1115006366 22 Left 1115006359 14:28490004-28490026 CCCCCCGTTTCCAAAGTGCTGAG 0: 1
1: 0
2: 2
3: 145
4: 3154
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228
1115006360_1115006366 21 Left 1115006360 14:28490005-28490027 CCCCCGTTTCCAAAGTGCTGAGA 0: 1
1: 0
2: 15
3: 249
4: 1903
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228
1115006363_1115006366 18 Left 1115006363 14:28490008-28490030 CCGTTTCCAAAGTGCTGAGACAG 0: 1
1: 0
2: 2
3: 32
4: 318
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228
1115006364_1115006366 12 Left 1115006364 14:28490014-28490036 CCAAAGTGCTGAGACAGAAGTTG 0: 1
1: 1
2: 2
3: 49
4: 937
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228
1115006361_1115006366 20 Left 1115006361 14:28490006-28490028 CCCCGTTTCCAAAGTGCTGAGAC 0: 1
1: 0
2: 3
3: 40
4: 281
Right 1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG 0: 1
1: 2
2: 2
3: 29
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115006366 Original CRISPR ATGTCCATCCAAAAGAATGA TGG Intergenic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906835267 1:49076639-49076661 ATGTGCTTCCTAGAGAATGATGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907604735 1:55805228-55805250 ACCTCCATCCAAAAGAGTCAGGG - Intergenic
908458367 1:64326091-64326113 ATGTCCAAGAAAAAGAAAGAGGG + Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
910303046 1:85728946-85728968 ATCCACATGCAAAAGAATGATGG - Intergenic
910848733 1:91629842-91629864 ATCCACATGCAAAAGAATGAAGG + Intergenic
911511562 1:98813249-98813271 ATGTCCAACCAAAAGGAGGCTGG + Intergenic
912398095 1:109364548-109364570 ATGTCAATCTAAAAAAATGAGGG + Intronic
913025274 1:114832375-114832397 CTGTCCATCCCAAAAAAGGAAGG + Intergenic
914893181 1:151646435-151646457 CTATCCATCCAAAAGAAGGCAGG - Intronic
916566547 1:165983845-165983867 ATGTGCTTCCAAAACAATGCTGG + Intergenic
917068076 1:171119326-171119348 GTGTCCATTCAAAATAATAAAGG + Intergenic
917209469 1:172616675-172616697 CTGTCCATCCAGAAAAAGGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920539658 1:206768791-206768813 ATGCCCATCCATGAGCATGAGGG - Intronic
921196010 1:212759061-212759083 ATATACATACAAAAGAATGAAGG + Intronic
921591749 1:217012177-217012199 ATGGCAATCCACTAGAATGACGG - Intronic
921775341 1:219092402-219092424 ATATCATTTCAAAAGAATGAAGG + Intergenic
921912493 1:220565443-220565465 CTGTTCCTCCAAAACAATGACGG - Intronic
922150866 1:223003082-223003104 AATTCCAACCAAAATAATGAGGG - Exonic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
924072984 1:240301602-240301624 ATGTCCTTCAAAAAAAAGGAAGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063653942 10:7968227-7968249 GTTTTCAGCCAAAAGAATGAAGG + Intronic
1064372812 10:14768581-14768603 ATCTACATGCAAAAGAATGATGG + Intronic
1065028457 10:21561634-21561656 ATCTACATGCAAAAGAATGTAGG - Intronic
1065346811 10:24756369-24756391 ATGTTCTTCCAATAGAATGCAGG + Intergenic
1066116667 10:32246686-32246708 TTGTCCATTTAAAAGAATTAAGG - Intergenic
1066511696 10:36106245-36106267 ATGTTCATTCAAGAGTATGAGGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067379346 10:45758812-45758834 CTGAGCATCAAAAAGAATGATGG - Intronic
1067887046 10:50099474-50099496 CTGAGCATCAAAAAGAATGATGG - Intronic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068314299 10:55321073-55321095 ATGGCCATTGAAAAGAAAGAAGG + Intronic
1069055885 10:63844350-63844372 ATGCCCATCCACACTAATGAGGG - Intergenic
1071034100 10:81222455-81222477 ATGTCAATCCAAAAGAAAGCAGG - Intergenic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1072227209 10:93381672-93381694 ATATCCATAAAATAGAATGAAGG + Intronic
1073502435 10:103952675-103952697 TTGTCCATGTCAAAGAATGAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1081292792 11:41347460-41347482 ATGTGCTTCAAAAAGAAAGAAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085547754 11:77336120-77336142 ATGGCCATCGAAATGATTGAAGG - Exonic
1086939366 11:92779472-92779494 ATGAACATCAAAAAGAATAATGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087580507 11:100045690-100045712 ATGTACATCTAAAAGAATTTAGG - Intronic
1088049422 11:105493184-105493206 ATGTGTATCAAAAATAATGAGGG + Intergenic
1088190470 11:107222744-107222766 TTTTCCCTCCAAAAAAATGAAGG + Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1089360977 11:117886295-117886317 GTTTCCATGCCAAAGAATGAGGG + Intergenic
1089851749 11:121503368-121503390 ATCCACATGCAAAAGAATGAAGG - Intronic
1090001363 11:122962186-122962208 ATGTCCATCTAATATAAGGAAGG - Intergenic
1090248429 11:125234464-125234486 ATGTGCATAGAGAAGAATGATGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091613492 12:2031546-2031568 ATGTCCATAGAAAATAAGGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097391257 12:59017147-59017169 ATTTATATCCTAAAGAATGATGG + Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1098753711 12:74329814-74329836 ATCTCAATCCATAATAATGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1104294216 12:127497061-127497083 TTTTCCATCCAACAGAATTATGG + Intergenic
1109513013 13:63404216-63404238 ATGTCCATGCAAAAGTTTGCTGG - Intergenic
1109930003 13:69203446-69203468 ATGACCATCCAAACTTATGAAGG - Intergenic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1111080876 13:83305633-83305655 ATGTCCATACAAGAGAAAGCAGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1117108522 14:52424309-52424331 ATGACCAGCCAAAAGAAGGCAGG - Intergenic
1117435866 14:55714724-55714746 ATGTCCATCAAAGAGAAGAATGG - Intergenic
1118059394 14:62118250-62118272 ATGTGCATTCCAAAGAAAGACGG + Intergenic
1118628554 14:67681439-67681461 ATCCACATGCAAAAGAATGAAGG + Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122186860 14:100005898-100005920 ATGCCAAACCAAAAGAGTGATGG - Intronic
1123104375 14:105831374-105831396 ACAGCCATTCAAAAGAATGAAGG - Intergenic
1124105470 15:26733920-26733942 ATCCACATGCAAAAGAATGAAGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129429675 15:75490499-75490521 ATCTCCATTCAAAAGAGAGAGGG + Intronic
1129900245 15:79142351-79142373 ATAACCATCCAAAAGAAGGATGG + Intergenic
1130307576 15:82724318-82724340 ATGTTCATTAAAAGGAATGAAGG - Intergenic
1130448532 15:84027904-84027926 TTGACCATCAAAAGGAATGAAGG + Intronic
1130966861 15:88704367-88704389 ATGTCCATCAACAAGAAAAAGGG - Intergenic
1132122223 15:99185954-99185976 CTGTCACTCCAAAGGAATGAAGG + Intronic
1133646322 16:7768072-7768094 ATGTACATAGAAAAGAATGTAGG - Intergenic
1135167656 16:20154963-20154985 ATCTACATGTAAAAGAATGAAGG - Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1139222939 16:65203044-65203066 TTATCCATCCACTAGAATGAAGG + Intergenic
1141779145 16:86146550-86146572 AAGTCAATCCAAAATAAGGAAGG - Intergenic
1142293536 16:89204321-89204343 ATCTTCATGCAAAAGAATGCAGG - Intergenic
1144732024 17:17533274-17533296 ATTCACATGCAAAAGAATGAAGG + Intronic
1146875027 17:36402643-36402665 ATCTACATGCAAAAGAATGTAGG - Intronic
1147064361 17:37910227-37910249 ATCTACATGCAAAAGAATGTAGG + Intergenic
1149939478 17:60848007-60848029 ATTTCTCTGCAAAAGAATGAAGG - Intronic
1153989472 18:10383549-10383571 ATCCACATGCAAAAGAATGAAGG - Intergenic
1155140533 18:23040285-23040307 ATGTCTATTCAATAGAATGATGG + Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156055736 18:32999948-32999970 AAGAACATCCATAAGAATGAAGG + Intronic
1156876443 18:42019431-42019453 ATGTGCAACCAAAAGTATTAAGG - Intronic
1157215951 18:45783604-45783626 AAGTCCATCTGAAAGAATCAGGG - Intergenic
1158951756 18:62501619-62501641 ATTCACATGCAAAAGAATGAAGG + Intergenic
1160278108 18:77458622-77458644 ATGTCCATACAAAAAAAAAAAGG - Intergenic
1162592228 19:11599357-11599379 GTGTCCAGCCAAATGGATGATGG + Intronic
1165793618 19:38506385-38506407 ATGTCCCCCCAAAAGGATCAGGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
930662923 2:54073180-54073202 ATCTACATACAAATGAATGAAGG + Intronic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
931477551 2:62605151-62605173 ATGTACATGCAAATGAATGCAGG + Intergenic
931773005 2:65515557-65515579 ATTTTTATCCAAAAGAATAAGGG - Intergenic
933361863 2:81296996-81297018 ATGACTAGCCTAAAGAATGATGG - Intergenic
939036618 2:137139293-137139315 ATGTCCATCTAAAAGAATGGAGG - Intronic
940786352 2:157985396-157985418 ATGTCCACCCACATGGATGAGGG + Intronic
941687866 2:168465930-168465952 ATGTCAAGCCAAGAAAATGAAGG - Intronic
942996861 2:182273096-182273118 ATCTTCCTCCAAAAGAAGGAAGG + Intronic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943948266 2:194094925-194094947 ATGTCAGTCCAAAAGGGTGAAGG - Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945214738 2:207421460-207421482 ATTTCTATCCAAAAAAATGCAGG + Intergenic
945385761 2:209198793-209198815 ATCTACATGCAAAAAAATGAAGG + Intergenic
947189798 2:227490716-227490738 AGGTCCACCCACAAGAATAATGG - Intronic
1172243324 20:33428103-33428125 ATAACCATTAAAAAGAATGAGGG + Intronic
1172476762 20:35244415-35244437 ATTCCCACCCAAAAGCATGAGGG - Intronic
1173244983 20:41330541-41330563 GTCTCCCTCCAAAAGAATGCAGG - Intergenic
1173383796 20:42570082-42570104 ATGTCCTTCCAAAGGACAGAGGG - Intronic
1174917648 20:54670159-54670181 TTGGCCCTCAAAAAGAATGATGG + Intergenic
1175510054 20:59518079-59518101 TGGACCATCCAGAAGAATGACGG - Intergenic
1175670825 20:60901340-60901362 ATTTTCATCCAAAAGAAAGATGG + Intergenic
1176907155 21:14515440-14515462 ATCTACATGCAAAAGAATGAAGG + Intronic
1179193628 21:39144374-39144396 ATGTCCAGCCAATGGAATGAGGG + Intergenic
1179373924 21:40832373-40832395 ATTTCCCTAAAAAAGAATGAGGG - Intronic
1180228169 21:46410376-46410398 ATGTTCTTCCAAAAAACTGAGGG - Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182188220 22:28430138-28430160 ATGTCCATTCAAAGTAATGAAGG + Intronic
1183829853 22:40411957-40411979 ATCTACATGCAAAAGAATGAAGG + Intronic
949364402 3:3265182-3265204 ATGTCCATAAAACAGAATCATGG - Intergenic
950199092 3:11030108-11030130 ATGTCAATACAAAAGAAAAATGG - Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951363984 3:21758205-21758227 CTATCCCTCCAGAAGAATGAAGG + Intronic
952125363 3:30293634-30293656 AATTTCATCCAAAATAATGAAGG - Intergenic
952910042 3:38176198-38176220 ATTTACATCAAGAAGAATGATGG + Intronic
953135474 3:40177933-40177955 ATGGCCATTCAAAAGAGAGAAGG - Intronic
954305281 3:49722343-49722365 ATGTCCATCCAGAAGCCTGTAGG + Exonic
955491217 3:59485099-59485121 CTATCCTTCCAAAAGAAAGATGG - Intergenic
956263477 3:67371455-67371477 ATGACCATCCAAAAGACAAAAGG - Intronic
957652210 3:83022552-83022574 CTGTGTATCCAAAAGACTGAAGG - Intergenic
958264064 3:91416874-91416896 ATGTCCATTCAACAGGAAGAGGG + Intergenic
958423791 3:93958458-93958480 GTGACTATCCACAAGAATGAAGG - Intronic
958959891 3:100499394-100499416 ATCCACATGCAAAAGAATGAAGG - Intronic
959871398 3:111332634-111332656 ATATCCATCAAAATGATTGAGGG + Intronic
960498879 3:118410911-118410933 ATTCACATGCAAAAGAATGAGGG - Intergenic
961179833 3:124867807-124867829 ATGTCCATTTTAAAAAATGATGG + Intronic
961966281 3:130906788-130906810 TTCTTCATGCAAAAGAATGAAGG + Intronic
964833628 3:160912633-160912655 ATATCCATGCAAAAGAGTTATGG + Intronic
966292658 3:178378418-178378440 ATTTCCATACAAAAAAATGTAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
970689899 4:18610942-18610964 ATGTGCATCTAAAAAAATAACGG + Intergenic
972674782 4:41249897-41249919 ATATTCATCCAAAAAAATGCTGG + Intergenic
974754423 4:66184927-66184949 ATGTCCAAACAAAAGTATGAAGG - Intergenic
975050776 4:69862075-69862097 ATGTCAAACAAAAAGAATGTGGG + Intergenic
976432270 4:84976165-84976187 ATATCCATTCATAAGAAAGAAGG - Intergenic
976520793 4:86023140-86023162 ATATACATGCAAAAGAATGAAGG - Intronic
976607778 4:86998552-86998574 ATGTGTATTCAAAAGATTGATGG - Intronic
978200417 4:106018705-106018727 ATGTCCATGCCAAGGAATGGAGG + Intergenic
978524521 4:109652094-109652116 ATGTACACCCAGAAGAAAGACGG - Intronic
980874930 4:138652107-138652129 ATGGCCAACAAAAAGAGTGAGGG + Intergenic
981514108 4:145588338-145588360 CTGGCCAGCCTAAAGAATGAGGG + Intergenic
982311237 4:153987478-153987500 ATGTCCATACATAACAATGAGGG + Intergenic
982656486 4:158155788-158155810 AGATGCATCCCAAAGAATGATGG + Intronic
982700162 4:158651924-158651946 ATTTCCACCCAGATGAATGATGG - Exonic
984232595 4:177116993-177117015 ATCACCATCCTAAAGAAAGAAGG + Intergenic
986608064 5:9542909-9542931 ATGTCCAGCCAAGAGTATAAAGG - Intronic
986792691 5:11179069-11179091 GTGTCCATCCAAGAGACTGTAGG - Intronic
987376288 5:17238043-17238065 ATATCCATCCAAAAGAGAGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990939965 5:61192134-61192156 ATGCCAATCCAAAAGTGTGAGGG + Intergenic
991113270 5:62925457-62925479 CTGTCCATGAAAAAGAATGTTGG - Intergenic
991236067 5:64398829-64398851 ATGTCCATAAAAAAGAATGCAGG + Intergenic
992260153 5:74961566-74961588 ATTTCCATCTAATAGAAAGATGG - Intergenic
992428779 5:76686812-76686834 ATCCACATGCAAAAGAATGAAGG - Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994068130 5:95566395-95566417 TTGGCCATCCAAGAAAATGAGGG + Intronic
995265872 5:110159926-110159948 ATGTGCATAGAAAATAATGAGGG - Intergenic
997258756 5:132449326-132449348 ATATCCATGGAAATGAATGAAGG + Intronic
998532454 5:142898521-142898543 AAGTCCAGAGAAAAGAATGAAGG - Intronic
1001352753 5:170985916-170985938 ATGTAAATTCAGAAGAATGAAGG - Intronic
1002126384 5:177048178-177048200 ATGCGCATCCAATAAAATGAGGG - Intronic
1002546845 5:179953567-179953589 ATCCACATGCAAAAGAATGAAGG + Intronic
1004981158 6:21025946-21025968 ATGTTCATTCAAAACAATGATGG - Intronic
1007785785 6:44278427-44278449 ATGTCCATTCAGAGGAAAGAAGG - Exonic
1008191593 6:48464609-48464631 ATGTCCATAAAAAAGAATAGAGG + Intergenic
1008455397 6:51705107-51705129 TTGTCCATATCAAAGAATGAGGG + Intronic
1008484141 6:52016965-52016987 ATGTTTATTCAAAAGAAGGAGGG - Intronic
1009197201 6:60701473-60701495 TTCTCCATCCAAAAGAGGGAGGG + Intergenic
1010129685 6:72476482-72476504 ATGTCCCTCCCAGAGAATAAGGG + Intergenic
1010743539 6:79536230-79536252 ATAACCATGCAAAAGAAAGAGGG + Intronic
1012333549 6:98025099-98025121 ATTTCAATCCTAAAGACTGATGG + Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013197121 6:107854479-107854501 ATTTGCATGCAAAAGAATGAAGG - Intergenic
1013299247 6:108787685-108787707 ATATCCATCCAGAAAAATAAAGG - Intergenic
1014045410 6:116878602-116878624 ATATCTATCTAAAAGAAAGACGG + Intronic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1014937562 6:127401683-127401705 ATGTCCAGTCAAAAAAAGGATGG + Intergenic
1016929598 6:149391119-149391141 ATGTCCAGCTAAAAATATGAGGG - Intronic
1019868785 7:3738247-3738269 ATCCACATGCAAAAGAATGAAGG - Intronic
1020206888 7:6124761-6124783 ATATCAATCCAAAAGAAGGCAGG - Intronic
1020219515 7:6224434-6224456 ATCCGCATGCAAAAGAATGAGGG + Intronic
1021140795 7:17022301-17022323 ATGGCCAACCAAAATAAAGATGG - Intergenic
1021745900 7:23741080-23741102 ATGGGCATCAAAAAGAATAATGG - Intronic
1022435469 7:30380067-30380089 ATGTCCAAACAAAAAACTGAAGG - Intronic
1023213290 7:37831552-37831574 AGGTCCATTCCAGAGAATGAAGG - Intronic
1024403578 7:48951915-48951937 ATTCCCATACAAAAGACTGAAGG - Intergenic
1027346499 7:77265201-77265223 ATGTCCATTCAAAGTACTGACGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030326528 7:108225062-108225084 ATTTCTATCTAAAATAATGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033479341 7:141723825-141723847 ATGTCCACACAAAAGAAGAAAGG + Intronic
1035212748 7:157340582-157340604 ATGTCCATACAAAAACATAAAGG - Intronic
1037146058 8:15574060-15574082 AGGTCCATCCAAGACAATAAAGG - Intronic
1038126664 8:24681359-24681381 TGGTTCATTCAAAAGAATGACGG + Intergenic
1042352592 8:67792744-67792766 ATCAACATCAAAAAGAATGAGGG - Intergenic
1042972035 8:74419857-74419879 ATCCACATGCAAAAGAATGAAGG - Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1045165114 8:99595418-99595440 ATTCCCATGCAAAAGAATGAAGG + Intronic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1047434882 8:124827973-124827995 ACGACCATTCAAAAGAATGAGGG - Intergenic
1049539940 8:143203809-143203831 ATGTCCTTACAAAAGAAAGCAGG - Intergenic
1049593896 8:143474716-143474738 TTGTCCATCAAAAAAAAAGAGGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050890067 9:10813501-10813523 ATGGCAACCCAAAATAATGAGGG + Intergenic
1051848782 9:21484363-21484385 AATTCAATCCAAAAGAAGGAAGG - Intergenic
1051882614 9:21855333-21855355 ATCTCCATCCGACAGAATGTCGG - Intronic
1052767773 9:32659317-32659339 ATTTCCATCCCAAAGATGGAGGG - Intergenic
1055724872 9:79216852-79216874 ATGTCCACCAAAAAGAATATGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056170769 9:83981808-83981830 ATGGCCATTTAAAAGAATGCTGG - Intronic
1056898447 9:90574633-90574655 ATTACCATACAAAAAAATGAGGG - Intergenic
1057295461 9:93833513-93833535 ATCCACATGCAAAAGAATGAAGG - Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058512914 9:105739059-105739081 ATCCACATACAAAAGAATGAAGG - Intronic
1059358540 9:113720184-113720206 TTGTCCTTCCAAAGGAAGGAAGG - Intergenic
1187862957 X:23699182-23699204 ATGTCCCTCTCAAAGAATAAAGG - Intergenic
1188579415 X:31691432-31691454 ATTTACATTCAAAATAATGATGG - Intronic
1188733953 X:33688689-33688711 AAGGCCATCCAAAAGGATGAGGG + Intergenic
1189188338 X:39073197-39073219 ATGTCCATCTAAAAGATGGCAGG + Intergenic
1191637748 X:63395844-63395866 ATATACATACAAAAGAATAATGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1191666426 X:63707326-63707348 CTGTCCATCCTAAATCATGAAGG + Intronic
1194209774 X:91058048-91058070 AACACAATCCAAAAGAATGAAGG + Intergenic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1196970764 X:121105941-121105963 ATTTCCTTCCAACAGACTGAAGG - Intergenic
1197804411 X:130385335-130385357 CTGTTGATCCACAAGAATGATGG - Exonic
1199490363 X:148391669-148391691 ATGTCACACCAAAAGAATGAAGG + Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic