ID: 1115006499

View in Genome Browser
Species Human (GRCh38)
Location 14:28491905-28491927
Sequence GACTGTCCTATCATTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115006499_1115006504 15 Left 1115006499 14:28491905-28491927 CCAAATAAAATGATAGGACAGTC No data
Right 1115006504 14:28491943-28491965 CCATTCCAACAGGAGGAAGTAGG No data
1115006499_1115006502 8 Left 1115006499 14:28491905-28491927 CCAAATAAAATGATAGGACAGTC No data
Right 1115006502 14:28491936-28491958 GACATTACCATTCCAACAGGAGG No data
1115006499_1115006506 29 Left 1115006499 14:28491905-28491927 CCAAATAAAATGATAGGACAGTC No data
Right 1115006506 14:28491957-28491979 GGAAGTAGGAAAGAAGAAAGAGG No data
1115006499_1115006501 5 Left 1115006499 14:28491905-28491927 CCAAATAAAATGATAGGACAGTC No data
Right 1115006501 14:28491933-28491955 ACAGACATTACCATTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115006499 Original CRISPR GACTGTCCTATCATTTTATT TGG (reversed) Intergenic
No off target data available for this crispr