ID: 1115006504

View in Genome Browser
Species Human (GRCh38)
Location 14:28491943-28491965
Sequence CCATTCCAACAGGAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115006499_1115006504 15 Left 1115006499 14:28491905-28491927 CCAAATAAAATGATAGGACAGTC No data
Right 1115006504 14:28491943-28491965 CCATTCCAACAGGAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115006504 Original CRISPR CCATTCCAACAGGAGGAAGT AGG Intergenic
No off target data available for this crispr