ID: 1115022354

View in Genome Browser
Species Human (GRCh38)
Location 14:28697863-28697885
Sequence AAGGAGAACAGATATGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115022354_1115022359 16 Left 1115022354 14:28697863-28697885 CCCGCCTCATATCTGTTCTCCTT No data
Right 1115022359 14:28697902-28697924 GCAAAAGAAAACTGACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115022354 Original CRISPR AAGGAGAACAGATATGAGGC GGG (reversed) Intergenic
No off target data available for this crispr