ID: 1115023144

View in Genome Browser
Species Human (GRCh38)
Location 14:28707571-28707593
Sequence CAGTGGGACCAAAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115023139_1115023144 26 Left 1115023139 14:28707522-28707544 CCTGAGAATACTACTTCAGTTCT No data
Right 1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG No data
1115023141_1115023144 -1 Left 1115023141 14:28707549-28707571 CCATTTTAAAGAAACAGGTTATC No data
Right 1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115023144 Original CRISPR CAGTGGGACCAAAAGCAAGA AGG Intergenic
No off target data available for this crispr