ID: 1115026701

View in Genome Browser
Species Human (GRCh38)
Location 14:28755408-28755430
Sequence CAAGAAAAGAAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115026690_1115026701 -2 Left 1115026690 14:28755387-28755409 CCCCTTTTCCAGTCCCCATCTCA No data
Right 1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG No data
1115026692_1115026701 -4 Left 1115026692 14:28755389-28755411 CCTTTTCCAGTCCCCATCTCAAG No data
Right 1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG No data
1115026691_1115026701 -3 Left 1115026691 14:28755388-28755410 CCCTTTTCCAGTCCCCATCTCAA No data
Right 1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG No data
1115026693_1115026701 -10 Left 1115026693 14:28755395-28755417 CCAGTCCCCATCTCAAGAAAAGA No data
Right 1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115026701 Original CRISPR CAAGAAAAGAAGAAGGGGGC AGG Intergenic
No off target data available for this crispr