ID: 1115028847

View in Genome Browser
Species Human (GRCh38)
Location 14:28771074-28771096
Sequence AAATATACACAAATGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115028842_1115028847 3 Left 1115028842 14:28771048-28771070 CCAGGAAAATTAAAAGAGCTGGA No data
Right 1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG No data
1115028839_1115028847 24 Left 1115028839 14:28771027-28771049 CCTAAGAAAAATATATAAGGGCC No data
Right 1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115028847 Original CRISPR AAATATACACAAATGGGGAA TGG Intergenic
No off target data available for this crispr