ID: 1115030207

View in Genome Browser
Species Human (GRCh38)
Location 14:28785456-28785478
Sequence GGAGGCGCTCCGCATTAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115030201_1115030207 -2 Left 1115030201 14:28785435-28785457 CCCTTCAGTCTTCAGGGAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030188_1115030207 22 Left 1115030188 14:28785411-28785433 CCGCCGGGACCCCGTCCCTCTTT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030199_1115030207 -1 Left 1115030199 14:28785434-28785456 CCCCTTCAGTCTTCAGGGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030194_1115030207 6 Left 1115030194 14:28785427-28785449 CCTCTTTCCCCTTCAGTCTTCAG 0: 1
1: 1
2: 1
3: 71
4: 510
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030189_1115030207 19 Left 1115030189 14:28785414-28785436 CCGGGACCCCGTCCCTCTTTCCC 0: 1
1: 0
2: 1
3: 43
4: 455
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030190_1115030207 13 Left 1115030190 14:28785420-28785442 CCCCGTCCCTCTTTCCCCTTCAG 0: 1
1: 0
2: 7
3: 48
4: 459
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030203_1115030207 -3 Left 1115030203 14:28785436-28785458 CCTTCAGTCTTCAGGGAGGGGGA 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030191_1115030207 12 Left 1115030191 14:28785421-28785443 CCCGTCCCTCTTTCCCCTTCAGT 0: 1
1: 0
2: 3
3: 53
4: 555
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030192_1115030207 11 Left 1115030192 14:28785422-28785444 CCGTCCCTCTTTCCCCTTCAGTC 0: 1
1: 3
2: 35
3: 204
4: 1536
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1115030193_1115030207 7 Left 1115030193 14:28785426-28785448 CCCTCTTTCCCCTTCAGTCTTCA 0: 1
1: 0
2: 6
3: 77
4: 697
Right 1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115030207 Original CRISPR GGAGGCGCTCCGCATTAGCG GGG Intronic
913451240 1:118994079-118994101 GGTGGCTCTCCGGAGTAGCGAGG - Intergenic
923518866 1:234720770-234720792 GCAGGGGCTCAGCATTAGCAAGG - Intergenic
1074987310 10:118669652-118669674 GCAGGCGCTCCGGATTACCATGG + Intergenic
1115030207 14:28785456-28785478 GGAGGCGCTCCGCATTAGCGGGG + Intronic
1116784722 14:49275116-49275138 TCAGGAGCTCCGCATTAGCTAGG - Intergenic
1120229843 14:81829957-81829979 GGAGGCGCTGAGCGTGAGCGAGG + Intergenic
1134260116 16:12644372-12644394 GGAGGCTCTCTGCATCAGCCTGG + Intergenic
1136912991 16:34159534-34159556 GGCGGCGCTCCGCATGGGCCTGG + Intergenic
1141770940 16:86089289-86089311 GGAGGTGATCCTCATTAGCCAGG + Intergenic
1164706819 19:30325919-30325941 GGAGGGGCTCCACAGTAGAGAGG - Intronic
1172793353 20:37521137-37521159 GGGGGCGCTCCTCATTCGCCAGG - Intronic
1173878881 20:46395519-46395541 GCAGGTGGTCCCCATTAGCGAGG - Intronic
1175260288 20:57669999-57670021 GGAGGGGCTCGGAATTAGGGTGG + Intronic
1181033549 22:20159346-20159368 GGAGGTGCTTCGCCTCAGCGGGG + Intergenic
1183924645 22:41197315-41197337 GGAGGCGCTGGGCGTCAGCGCGG - Intergenic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
1010057674 6:71585227-71585249 GCAGGCTCTGCGCATGAGCGCGG + Intergenic
1039857795 8:41431424-41431446 GGAGGCGCACAGCAGCAGCGTGG - Intergenic
1049801641 8:144520454-144520476 GGAGGCACTCCGAAGCAGCGTGG + Exonic
1055574436 9:77647736-77647758 GGAGTCGCAGCGCATCAGCGCGG - Exonic
1200118149 X:153778222-153778244 GGAGGCGCTAGGCATGAGCTCGG - Intronic