ID: 1115034168

View in Genome Browser
Species Human (GRCh38)
Location 14:28837430-28837452
Sequence AGGGTGAATTTTGAGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115034168_1115034171 1 Left 1115034168 14:28837430-28837452 CCTCTCAGCTCAAAATTCACCCT No data
Right 1115034171 14:28837454-28837476 CAAAACCTTTTCTACACCAATGG 0: 1
1: 0
2: 0
3: 21
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115034168 Original CRISPR AGGGTGAATTTTGAGCTGAG AGG (reversed) Intergenic
No off target data available for this crispr