ID: 1115045790

View in Genome Browser
Species Human (GRCh38)
Location 14:28991587-28991609
Sequence CCTTGCAAAAATGAGTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115045790_1115045792 -5 Left 1115045790 14:28991587-28991609 CCTCAAGACTCATTTTTGCAAGG No data
Right 1115045792 14:28991605-28991627 CAAGGTGTGATTTTTTTTATTGG No data
1115045790_1115045793 -4 Left 1115045790 14:28991587-28991609 CCTCAAGACTCATTTTTGCAAGG No data
Right 1115045793 14:28991606-28991628 AAGGTGTGATTTTTTTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115045790 Original CRISPR CCTTGCAAAAATGAGTCTTG AGG (reversed) Intergenic
No off target data available for this crispr