ID: 1115050593

View in Genome Browser
Species Human (GRCh38)
Location 14:29057010-29057032
Sequence ATAAGGTATCTAGAGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115050586_1115050593 29 Left 1115050586 14:29056958-29056980 CCAACAAAAAACAAAAAACAAAA 0: 5
1: 120
2: 851
3: 20822
4: 41448
Right 1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG No data
1115050589_1115050593 3 Left 1115050589 14:29056984-29057006 CCACAGCAGAAAGGACAGCTCAA No data
Right 1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG No data
1115050588_1115050593 4 Left 1115050588 14:29056983-29057005 CCCACAGCAGAAAGGACAGCTCA No data
Right 1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115050593 Original CRISPR ATAAGGTATCTAGAGAAGTT TGG Intergenic
No off target data available for this crispr