ID: 1115050741

View in Genome Browser
Species Human (GRCh38)
Location 14:29059634-29059656
Sequence CTTGCTTACATCTTGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115050741_1115050744 16 Left 1115050741 14:29059634-29059656 CCATGTATCAAGATGTAAGCAAG No data
Right 1115050744 14:29059673-29059695 CAAGAAGCATATACTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115050741 Original CRISPR CTTGCTTACATCTTGATACA TGG (reversed) Intergenic
No off target data available for this crispr