ID: 1115051223

View in Genome Browser
Species Human (GRCh38)
Location 14:29065922-29065944
Sequence AGATTGTTATAGGTGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115051223_1115051226 16 Left 1115051223 14:29065922-29065944 CCATGGTCCACCTATAACAATCT No data
Right 1115051226 14:29065961-29065983 TGTTAAGCTCTTCCCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115051223 Original CRISPR AGATTGTTATAGGTGGACCA TGG (reversed) Intergenic
No off target data available for this crispr