ID: 1115051226

View in Genome Browser
Species Human (GRCh38)
Location 14:29065961-29065983
Sequence TGTTAAGCTCTTCCCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115051223_1115051226 16 Left 1115051223 14:29065922-29065944 CCATGGTCCACCTATAACAATCT No data
Right 1115051226 14:29065961-29065983 TGTTAAGCTCTTCCCATCTCAGG No data
1115051225_1115051226 6 Left 1115051225 14:29065932-29065954 CCTATAACAATCTTCTAGCTTTT No data
Right 1115051226 14:29065961-29065983 TGTTAAGCTCTTCCCATCTCAGG No data
1115051222_1115051226 28 Left 1115051222 14:29065910-29065932 CCTCTTTGCTTGCCATGGTCCAC No data
Right 1115051226 14:29065961-29065983 TGTTAAGCTCTTCCCATCTCAGG No data
1115051224_1115051226 9 Left 1115051224 14:29065929-29065951 CCACCTATAACAATCTTCTAGCT No data
Right 1115051226 14:29065961-29065983 TGTTAAGCTCTTCCCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115051226 Original CRISPR TGTTAAGCTCTTCCCATCTC AGG Intergenic
No off target data available for this crispr