ID: 1115058252

View in Genome Browser
Species Human (GRCh38)
Location 14:29157369-29157391
Sequence TCTTGCAACCCTCGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115058249_1115058252 -7 Left 1115058249 14:29157353-29157375 CCAATTCAACCCTTACTCTTGCA No data
Right 1115058252 14:29157369-29157391 TCTTGCAACCCTCGTTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115058252 Original CRISPR TCTTGCAACCCTCGTTTTAC AGG Intergenic
No off target data available for this crispr