ID: 1115059717

View in Genome Browser
Species Human (GRCh38)
Location 14:29173905-29173927
Sequence GACAGCTCTTGGCTTGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115059714_1115059717 15 Left 1115059714 14:29173867-29173889 CCTGTCATCTTCTGCAGATAACT 0: 21
1: 199
2: 184
3: 120
4: 249
Right 1115059717 14:29173905-29173927 GACAGCTCTTGGCTTGTAACTGG No data
1115059713_1115059717 16 Left 1115059713 14:29173866-29173888 CCCTGTCATCTTCTGCAGATAAC No data
Right 1115059717 14:29173905-29173927 GACAGCTCTTGGCTTGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115059717 Original CRISPR GACAGCTCTTGGCTTGTAAC TGG Intergenic
No off target data available for this crispr