ID: 1115063254

View in Genome Browser
Species Human (GRCh38)
Location 14:29220704-29220726
Sequence CTGTCTGTGCATAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115063249_1115063254 1 Left 1115063249 14:29220680-29220702 CCGTGTATGAGTGAGACAGATGG No data
Right 1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115063254 Original CRISPR CTGTCTGTGCATAGAGAGGA GGG Intergenic
No off target data available for this crispr