ID: 1115070666

View in Genome Browser
Species Human (GRCh38)
Location 14:29318382-29318404
Sequence CTTATAGAGGTCAGAGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115070664_1115070666 -4 Left 1115070664 14:29318363-29318385 CCATAAGTCAGAGTAGCAGCTTA No data
Right 1115070666 14:29318382-29318404 CTTATAGAGGTCAGAGTCAATGG No data
1115070663_1115070666 14 Left 1115070663 14:29318345-29318367 CCTAAACATCACTGTGGTCCATA No data
Right 1115070666 14:29318382-29318404 CTTATAGAGGTCAGAGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115070666 Original CRISPR CTTATAGAGGTCAGAGTCAA TGG Intergenic
No off target data available for this crispr