ID: 1115070785

View in Genome Browser
Species Human (GRCh38)
Location 14:29319635-29319657
Sequence AACAGCTCTTAGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115070783_1115070785 15 Left 1115070783 14:29319597-29319619 CCTGGCATCCTTTGTGGATAACT No data
Right 1115070785 14:29319635-29319657 AACAGCTCTTAGCCTGCTACTGG No data
1115070784_1115070785 7 Left 1115070784 14:29319605-29319627 CCTTTGTGGATAACTTCTCTGTC No data
Right 1115070785 14:29319635-29319657 AACAGCTCTTAGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115070785 Original CRISPR AACAGCTCTTAGCCTGCTAC TGG Intergenic
No off target data available for this crispr