ID: 1115075938

View in Genome Browser
Species Human (GRCh38)
Location 14:29390470-29390492
Sequence GTTCCATATAATTACCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115075938_1115075941 23 Left 1115075938 14:29390470-29390492 CCATTAAGGTAATTATATGGAAC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1115075941 14:29390516-29390538 GATGTTAATGTTTGTCTAATTGG No data
1115075938_1115075942 30 Left 1115075938 14:29390470-29390492 CCATTAAGGTAATTATATGGAAC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1115075942 14:29390523-29390545 ATGTTTGTCTAATTGGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115075938 Original CRISPR GTTCCATATAATTACCTTAA TGG (reversed) Intergenic