ID: 1115082092

View in Genome Browser
Species Human (GRCh38)
Location 14:29466790-29466812
Sequence GGTTGATAACAAATGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115082089_1115082092 15 Left 1115082089 14:29466752-29466774 CCACATATTGTTATCAAAATGTG No data
Right 1115082092 14:29466790-29466812 GGTTGATAACAAATGCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115082092 Original CRISPR GGTTGATAACAAATGCTAAC TGG Intergenic
No off target data available for this crispr