ID: 1115083172

View in Genome Browser
Species Human (GRCh38)
Location 14:29481857-29481879
Sequence ATATGATGCTAGCAGTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115083170_1115083172 2 Left 1115083170 14:29481832-29481854 CCTGGCCTCGTCTTTAAACTAGA No data
Right 1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG No data
1115083168_1115083172 21 Left 1115083168 14:29481813-29481835 CCTTAATATAAGCGATGAGCCTG No data
Right 1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG No data
1115083171_1115083172 -3 Left 1115083171 14:29481837-29481859 CCTCGTCTTTAAACTAGAAAATA No data
Right 1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG No data
1115083167_1115083172 26 Left 1115083167 14:29481808-29481830 CCATTCCTTAATATAAGCGATGA No data
Right 1115083172 14:29481857-29481879 ATATGATGCTAGCAGTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115083172 Original CRISPR ATATGATGCTAGCAGTTGTA AGG Intergenic
No off target data available for this crispr