ID: 1115085738

View in Genome Browser
Species Human (GRCh38)
Location 14:29512969-29512991
Sequence TGTACCCTGCAAAGCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5305
Summary {0: 907, 1: 1362, 2: 1353, 3: 919, 4: 764}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085738_1115085747 22 Left 1115085738 14:29512969-29512991 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085738_1115085742 2 Left 1115085738 14:29512969-29512991 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data
1115085738_1115085745 6 Left 1115085738 14:29512969-29512991 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1115085745 14:29512998-29513020 CTCCAGCTGCTTTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085738 Original CRISPR TGTACCCTGCAAAGCCACAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr