ID: 1115085739

View in Genome Browser
Species Human (GRCh38)
Location 14:29512970-29512992
Sequence CTGTACCCTGCAAAGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5473
Summary {0: 877, 1: 1466, 2: 1338, 3: 996, 4: 796}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085739_1115085745 5 Left 1115085739 14:29512970-29512992 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1115085745 14:29512998-29513020 CTCCAGCTGCTTTCACAGGCTGG No data
1115085739_1115085747 21 Left 1115085739 14:29512970-29512992 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085739_1115085742 1 Left 1115085739 14:29512970-29512992 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085739 Original CRISPR CTGTACCCTGCAAAGCCACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr